Transcript: Human NM_001256460.1

Homo sapiens integrator complex subunit 11 (INTS11), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
INTS11 (54973)
Length:
2275
CDS:
274..1989

Additional Resources:

NCBI RefSeq record:
NM_001256460.1
NBCI Gene record:
INTS11 (54973)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256460.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353689 TGGTCTACACGGGTGATTATA pLKO_005 704 CDS 100% 15.000 21.000 N INTS11 n/a
2 TRCN0000119578 GCAGCCATGTTCCAGATTAAA pLKO.1 667 CDS 100% 15.000 10.500 N Ints11 n/a
3 TRCN0000161070 GCAGCCATGTTCCAGATTAAA pLKO.1 667 CDS 100% 15.000 10.500 N INTS11 n/a
4 TRCN0000330656 GAATGCACATGGGCTTCAATG pLKO_005 287 CDS 100% 10.800 7.560 N INTS11 n/a
5 TRCN0000163343 GAGCGAGACTTCCTGAAGAAA pLKO.1 838 CDS 100% 5.625 3.938 N INTS11 n/a
6 TRCN0000162386 CCACTACTACAAGCTGTTCAT pLKO.1 1014 CDS 100% 4.950 3.465 N INTS11 n/a
7 TRCN0000164524 CCAGAAGATCCGCAAGACTTT pLKO.1 1047 CDS 100% 4.950 3.465 N INTS11 n/a
8 TRCN0000330654 CCAGAAGATCCGCAAGACTTT pLKO_005 1047 CDS 100% 4.950 3.465 N INTS11 n/a
9 TRCN0000159677 GAGGAACATGTTTGAGTTCAA pLKO.1 1074 CDS 100% 4.950 3.465 N INTS11 n/a
10 TRCN0000330655 GAGGAACATGTTTGAGTTCAA pLKO_005 1074 CDS 100% 4.950 3.465 N INTS11 n/a
11 TRCN0000162303 CAACCACTACTACAAGCTGTT pLKO.1 1011 CDS 100% 4.050 2.835 N INTS11 n/a
12 TRCN0000162071 CCAGATGATCAAAGACTGCAT pLKO.1 555 CDS 100% 2.640 1.848 N INTS11 n/a
13 TRCN0000353763 TCCTGGACTGTGTGATCATTA pLKO_005 365 CDS 100% 13.200 7.920 N INTS11 n/a
14 TRCN0000161507 GCAGAGGAACATGTTTGAGTT pLKO.1 1071 CDS 100% 4.950 2.970 N INTS11 n/a
15 TRCN0000162041 CAAGAAGATGGAGTTCCTGAA pLKO.1 1437 CDS 100% 4.050 2.430 N INTS11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256460.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12126 pDONR223 98.7% 59.8% 60% None (many diffs) n/a
2 ccsbBroad304_12126 pLX_304 0% 59.8% 60% V5 (many diffs) n/a
3 ccsbBroadEn_14181 pDONR223 100% 52.8% 52.7% None 1_807del;1064T>C n/a
4 ccsbBroad304_14181 pLX_304 0% 52.8% 52.7% V5 1_807del;1064T>C n/a
5 TRCN0000471109 TCGACATCCTTTCTGCGCACGCAC pLX_317 47% 52.8% 52.7% V5 1_807del;1064T>C n/a
Download CSV