Transcript: Mouse XM_006539195.2

PREDICTED: Mus musculus cleavage and polyadenylation specific factor 3-like (Cpsf3l), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ints11 (71957)
Length:
1563
CDS:
471..1379

Additional Resources:

NCBI RefSeq record:
XM_006539195.2
NBCI Gene record:
Ints11 (71957)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006539195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119581 GCTATTGGTCTCCTGGACTTA pLKO.1 1289 CDS 100% 4.950 3.465 N Ints11 n/a
2 TRCN0000332339 GCTATTGGTCTCCTGGACTTA pLKO_005 1289 CDS 100% 4.950 3.465 N Ints11 n/a
3 TRCN0000119577 CCTGAGTAAATGGGAGACCAT pLKO.1 1461 3UTR 100% 2.640 1.848 N Ints11 n/a
4 TRCN0000162041 CAAGAAGATGGAGTTCCTGAA pLKO.1 827 CDS 100% 4.050 2.430 N INTS11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006539195.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14181 pDONR223 100% 85.2% 95.3% None (many diffs) n/a
2 ccsbBroad304_14181 pLX_304 0% 85.2% 95.3% V5 (many diffs) n/a
3 TRCN0000471109 TCGACATCCTTTCTGCGCACGCAC pLX_317 47% 85.2% 95.3% V5 (many diffs) n/a
4 ccsbBroadEn_12126 pDONR223 98.7% 37.4% 42% None (many diffs) n/a
5 ccsbBroad304_12126 pLX_304 0% 37.4% 42% V5 (many diffs) n/a
Download CSV