Construct: ORF TRCN0000471341
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000183.1_s317c1
- Derived from:
- ccsbBroadEn_13382
- DNA Barcode:
- ACAATTGTTCTTGGAACGGTTGCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VWA3B (200403)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471341
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 200403 | VWA3B | von Willebrand factor A dom... | XM_006712359.3 | 46% | 44.2% | (many diffs) |
| 2 | human | 200403 | VWA3B | von Willebrand factor A dom... | NM_001345864.2 | 42.9% | 42.4% | (many diffs) |
| 3 | human | 200403 | VWA3B | von Willebrand factor A dom... | XM_017003561.1 | 39.6% | 37.9% | (many diffs) |
| 4 | human | 200403 | VWA3B | von Willebrand factor A dom... | XM_017003562.1 | 39.6% | 37.9% | (many diffs) |
| 5 | human | 200403 | VWA3B | von Willebrand factor A dom... | XM_024452744.1 | 39.6% | 37.9% | (many diffs) |
| 6 | human | 200403 | VWA3B | von Willebrand factor A dom... | XM_006712357.2 | 33.1% | 31.7% | (many diffs) |
| 7 | human | 200403 | VWA3B | von Willebrand factor A dom... | NM_144992.5 | 31.5% | 31.2% | (many diffs) |
| 8 | human | 200403 | VWA3B | von Willebrand factor A dom... | XM_011510771.2 | 30.3% | 29% | (many diffs) |
| 9 | human | 200403 | VWA3B | von Willebrand factor A dom... | XM_011510770.1 | 30.2% | 29.9% | (many diffs) |
| 10 | human | 200403 | VWA3B | von Willebrand factor A dom... | XM_005263897.2 | 29.3% | 28.1% | (many diffs) |
| 11 | human | 200403 | VWA3B | von Willebrand factor A dom... | XR_922884.1 | 28.6% | (many diffs) | |
| 12 | human | 200403 | VWA3B | von Willebrand factor A dom... | XR_922885.3 | 28.5% | (many diffs) | |
| 13 | human | 200403 | VWA3B | von Willebrand factor A dom... | XM_011510772.1 | 28% | 27.6% | (many diffs) |
| 14 | human | 200403 | VWA3B | von Willebrand factor A dom... | NR_144296.2 | 23.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1314
- ORF length:
- 1248
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cacgaaaggc atgaggttga aatccacaaa agaggtgttc cctctggcac 121 atgtgtgcaa cgacacaaat aagatgacat taattaaccc ccaaggagcc aaactcaata 181 tctacaagcg aaaagtggaa caggcaattc aatcctatga aaagcgcttg aataaaattg 241 tttggcgagc attatctcaa gaggaaaaag aaaagttaga tgcaaacaaa ccaatacagt 301 acttggaaaa caaaacagtt ttaaaccagg ctttagaacg gttgaattgg cccatttcac 361 tgaaagagct gtcgatgctg gaaagtgaaa tcctagctgg gaaaatgtac atccagcagg 421 ccatggaact ccaggaggct gccaagaaga attatgcaaa caaggccccg ggagagcaac 481 agaaattgca aggaaatcca acaaagaaaa ccaaatcaaa aagaccagat cccctcaaag 541 gacagaaggt tattgcaaga tgcgatgaaa atggctttta ttttccaggg gttgtgaaga 601 agtgtgtgag ccgcacccaa gcactggtgg gcttcagtta cggagacacc aaggtcgtgt 661 ccacctcctt catcacgcct gtggggggcg ccatgccctg cccgctgctc caggttggag 721 attatgtgtt tgccaaaatt gtgataccca aaggatttga cttctatgtc cctgccattg 781 tcatagcact tcccaataag catgtggcca cagaaaaatt ctacacagtt ttgaagtgta 841 acaaccggag agaattttgc cctcggagtg cacttattaa gatcagccaa aacaagtatg 901 cgctctcttg ctctcatata aagtcacccc caattccTGA GGGTCCAGAA GTAGAGGATG 961 TGGAGGCGAG GAACTCTGCT TTCCTCTTCT GGCCACTGAA AGAAGCGGAC ACGCAGGATT 1021 CCAGAGAGCC AAGACGAGAG AAGCCCAGGA GGAAAAAGAG GCCCGCCAAG CAGCCACTCC 1081 AGCAGGCGGC GCCCTCGGAC TCGGACGGCT CCTCCCACGG CATCAGCTCC CATGGGTCCT 1141 GCCAGGGGAC ACACCCCGAG CCCAAGACAG CCCACCTCCA CTTCCCCGCG GCCGGGCGTC 1201 TAGGACTCAG CAGCCACGCC ATCATTGCCA CACCTCCACC TCGAGCAGCC CTGCCCTGTA 1261 CTCTCCAAGC CACCCACAGC AGCAAAGGGC TGAGGAGCGT CCCTGAGACA CTTTACCCAA 1321 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1381 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1441 TATCTTGTGG AAAGGACGAA CAATTGTTCT TGGAACGGTT GCTACGCGTT AAGTCgacaa 1501 tcaacctctg gattacaaaa tttgtgaaag att