Transcript: Human XM_006712357.2

PREDICTED: Homo sapiens von Willebrand factor A domain containing 3B (VWA3B), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VWA3B (200403)
Length:
4017
CDS:
429..3917

Additional Resources:

NCBI RefSeq record:
XM_006712357.2
NBCI Gene record:
VWA3B (200403)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712357.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242976 GCTTGGTCCACGTCAACATTA pLKO_005 1360 CDS 100% 13.200 18.480 N VWA3B n/a
2 TRCN0000242978 ATGTCGTGTCTAAGGTCTTTG pLKO_005 2626 CDS 100% 10.800 15.120 N VWA3B n/a
3 TRCN0000242979 CAAGACTATTGAATCCATTTA pLKO_005 674 CDS 100% 13.200 9.240 N VWA3B n/a
4 TRCN0000172236 CCAGAGGCTGTTCAGAATGAA pLKO.1 1983 CDS 100% 5.625 3.938 N VWA3B n/a
5 TRCN0000087239 GACAAGATCATTCAGTTCATA pLKO.1 1560 CDS 100% 5.625 3.938 N Vwa3b n/a
6 TRCN0000167799 GATACCCAAAGGATTTGACTT pLKO.1 3290 CDS 100% 4.950 3.465 N VWA3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712357.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13382 pDONR223 100% 33.1% 31.7% None (many diffs) n/a
2 ccsbBroad304_13382 pLX_304 0% 33.1% 31.7% V5 (many diffs) n/a
3 TRCN0000471341 ACAATTGTTCTTGGAACGGTTGCT pLX_317 30.5% 33.1% 31.7% V5 (many diffs) n/a
Download CSV