Construct: ORF TRCN0000471416
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009632.1_s317c1
- Derived from:
- ccsbBroadEn_06150
- DNA Barcode:
- AGCTTATAGAAACCCTCGGGAACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- EIF4E (1977)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471416
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 1977 | EIF4E | eukaryotic translation init... | NM_001968.4 | 99.6% | 99.5% | 241T>C;379G>A |
2 | human | 1977 | EIF4E | eukaryotic translation init... | NM_001130678.3 | 90.7% | 89.4% | (many diffs) |
3 | human | 1977 | EIF4E | eukaryotic translation init... | NM_001331017.1 | 87.8% | 85.7% | (many diffs) |
4 | human | 1977 | EIF4E | eukaryotic translation init... | NM_001130679.2 | 87.2% | 87% | 241T>C;379G>A;400_492del |
5 | mouse | 13684 | Eif4e | eukaryotic translation init... | NM_007917.4 | 93.7% | 97.6% | (many diffs) |
6 | mouse | 13684 | Eif4e | eukaryotic translation init... | XM_006500993.3 | 88.4% | 92.1% | (many diffs) |
7 | mouse | 13684 | Eif4e | eukaryotic translation init... | NM_001313980.1 | 57.4% | 59.9% | (many diffs) |
8 | mouse | 13684 | Eif4e | eukaryotic translation init... | XM_017319453.1 | 57.4% | 59.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 717
- ORF length:
- 651
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gactgtcgaa ccggaaacca cccctactcc taatcccccg actacagaag 121 aggagaaaac ggaatctaat caggaggttg ctaacccaga acactatatt aaacatcccc 181 tacagaacag atgggcactc tggtttttta aaaatgataa aagcaaaact tggcaagcaa 241 acctgcggct gatctccaag tttgatactg ttgaagactt ttgggctctg tacaaccata 301 tccagctgtc tagtaattta atgcctggct gtgactactc actttttaag gatggtattg 361 agccTATGTG GGAAGATGAG AAAAACAAAC GGGGAGGACG ATGGCTAATT ACATTGAACA 421 AACAGCAGAG ACGAAGTGAC CTCAATCGCT TTTGGCTAGA GACACTTCTG TGCCTTATTG 481 GAGAATCTTT TGATGACTAC AGTGATGATG TATGTGGCGC TGTTGTTAAT GTTAGAGCTA 541 AAGGTGATAA GATAGCAATA TGGACTACTG AATGTGAAAA CAGAGAAGCT GTTACACATA 601 TAGGGAGGGT ATACAAGGAA AGGTTAGGAC TTCCTCCAAA GATAGTGATT GGTTATCAGT 661 CCCACGCAGA CACAGCTACT AAGAGCGGCT CCACCACTAA AAATAGGTTT GTTGTTTACC 721 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 781 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 841 ATATATCTTG TGGAAAGGAC GAAGCTTATA GAAACCCTCG GGAACCACGC GTTAAGTCga 901 caatcaacct ctggattaca aaatttgtga aagatt