Transcript: Mouse NM_007917.4

Mus musculus eukaryotic translation initiation factor 4E (Eif4e), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Eif4e (13684)
Length:
4999
CDS:
134..787

Additional Resources:

NCBI RefSeq record:
NM_007917.4
NBCI Gene record:
Eif4e (13684)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007917.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077475 CCGAAGATAGTGATTGGTTAT pLKO.1 704 CDS 100% 10.800 15.120 N Eif4e n/a
2 TRCN0000077477 CGATTGATCTCTAAGTTTGAT pLKO.1 314 CDS 100% 5.625 7.875 N Eif4e n/a
3 TRCN0000077473 GCTCTTTAAGTGGTGGTTGTT pLKO.1 2402 3UTR 100% 4.950 6.930 N Eif4e n/a
4 TRCN0000077474 CCTTCGATTGATCTCTAAGTT pLKO.1 310 CDS 100% 5.625 3.938 N Eif4e n/a
5 TRCN0000077476 GCAAGCAAACCTTCGATTGAT pLKO.1 301 CDS 100% 5.625 3.938 N Eif4e n/a
6 TRCN0000062577 CTGTTGTTAATGTTAGAGCTA pLKO.1 588 CDS 100% 2.640 1.848 N EIF4E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007917.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06150 pDONR223 100% 93.7% 97.6% None (many diffs) n/a
2 ccsbBroad304_06150 pLX_304 93.5% 93.7% 97.6% V5 (many diffs) n/a
3 TRCN0000471416 AGCTTATAGAAACCCTCGGGAACC pLX_317 54% 93.7% 97.6% V5 (many diffs) n/a
Download CSV