Construct: ORF TRCN0000471422
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005435.1_s317c1
- Derived from:
- ccsbBroadEn_01524
- DNA Barcode:
- CTGGATAAACTCTTTCAAATCTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SRSF5 (6430)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471422
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6430 | SRSF5 | serine and arginine rich sp... | NM_001039465.2 | 100% | 100% | |
| 2 | human | 6430 | SRSF5 | serine and arginine rich sp... | NM_001320214.2 | 100% | 100% | |
| 3 | human | 6430 | SRSF5 | serine and arginine rich sp... | NM_006925.5 | 100% | 100% | |
| 4 | human | 6430 | SRSF5 | serine and arginine rich sp... | XM_005267999.2 | 99.6% | 99.6% | 549_550insAGT |
| 5 | human | 6430 | SRSF5 | serine and arginine rich sp... | XM_005268000.2 | 99.6% | 99.6% | 549_550insAGT |
| 6 | human | 6430 | SRSF5 | serine and arginine rich sp... | XM_017021593.2 | 99.6% | 99.6% | 549_550insAGT |
| 7 | human | 6430 | SRSF5 | serine and arginine rich sp... | XM_011537077.3 | 87.8% | 87.8% | 196_197ins99 |
| 8 | human | 6430 | SRSF5 | serine and arginine rich sp... | XM_017021594.2 | 53.3% | 53.3% | 0_1ins381 |
| 9 | human | 6430 | SRSF5 | serine and arginine rich sp... | XR_001750508.2 | 39.6% | 1_163del;528_1059del;1512_2058del | |
| 10 | human | 6430 | SRSF5 | serine and arginine rich sp... | XR_001750513.2 | 39.5% | (many diffs) | |
| 11 | human | 6430 | SRSF5 | serine and arginine rich sp... | XR_001750512.1 | 37.9% | 1_258del;623_1154del;1607_2153del | |
| 12 | human | 6430 | SRSF5 | serine and arginine rich sp... | XR_943506.2 | 32.9% | 1_159del;524_1479del;1932_2478del | |
| 13 | human | 6430 | SRSF5 | serine and arginine rich sp... | XR_943505.2 | 32.8% | 1_163del;528_1483del;1936_2482del | |
| 14 | human | 6430 | SRSF5 | serine and arginine rich sp... | XR_001750514.2 | 32.8% | (many diffs) | |
| 15 | human | 6430 | SRSF5 | serine and arginine rich sp... | XR_001750510.2 | 32.7% | (many diffs) | |
| 16 | human | 6430 | SRSF5 | serine and arginine rich sp... | XR_001750509.1 | 31.6% | 1_258del;623_1578del;2031_2577del | |
| 17 | mouse | 20384 | Srsf5 | serine/arginine-rich splici... | NM_001347415.1 | 92.6% | 98.1% | (many diffs) |
| 18 | mouse | 20384 | Srsf5 | serine/arginine-rich splici... | NM_001347416.1 | 92.6% | 98.1% | (many diffs) |
| 19 | mouse | 20384 | Srsf5 | serine/arginine-rich splici... | XM_006515630.3 | 92.6% | 98.1% | (many diffs) |
| 20 | mouse | 20384 | Srsf5 | serine/arginine-rich splici... | NM_001079694.2 | 92.4% | 97.7% | (many diffs) |
| 21 | mouse | 20384 | Srsf5 | serine/arginine-rich splici... | NM_001079695.2 | 92.4% | 97.7% | (many diffs) |
| 22 | mouse | 20384 | Srsf5 | serine/arginine-rich splici... | NM_009159.3 | 92.4% | 97.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 882
- ORF length:
- 816
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag tggctgtcgg gtattcatcg ggagactaaa tccagcggcc agggagaagg 121 acgtggaaag attcttcaag ggatatggac ggataagaga tattgatctg aaaagaggct 181 ttggttttgt ggaatttgag gatccaaggg atgcagatga tgctgtgtat gagcttgatg 241 gaaaagaact ctgtagtgaa agggttacta ttgaacatgc tagggctcgg tcacgaggtg 301 gaagaggtag aggacgatac tctgaccgtt ttagtagtcg cagacctcga aatgatagac 361 gaaatgctcc acctgtaaga acagaaaatc gtcttatagt tgagaattta tcctcaagag 421 tcagctggca ggatctcaaa gatttcatga gacaagctgg ggaagtaacg tttgcggatg 481 cacaccgacc taaattaaat gaaggggtgg ttgagtttgc ctcttatggt gacttaaaga 541 atgctattga aaaactttct GGAAAGGAAA TAAATGGGAG AAAAATAAAA TTAATTGAAG 601 GCAGCAAAAG GCACAGTAGG TCAAGAAGCA GGTCTCGATC CCGGACCAGA AGTTCCTCTA 661 GGTCTCGTAG CCGATCCCGT TCCCGTAGTC GCAAATCTTA CAGCCGGTCA AGAAGCAGGA 721 GCAGGAGCCG GAGCCGGAGC AAGTCCCGTT CTGTTAGTAG GTCTCCCGTG CCTGAGAAGA 781 GCCAGAAACG TGGTTCTTCA AGTAGATCTA AGTCTCCAGC ATCTGTGGAT CGCCAGAGGT 841 CCCGGTCCCG ATCAAGGTCC AGATCAGTTG ACAGTGGCAA TTACCCAACT TTCTTGTACA 901 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 961 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1021 AGGACGACTG GATAAACTCT TTCAAATCTA AACGCGTTAA GTCgacaatc aacctctgga 1081 ttacaaaatt tgtgaaagat t