Transcript: Mouse NM_009159.3

Mus musculus serine/arginine-rich splicing factor 5 (Srsf5), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Srsf5 (20384)
Length:
1580
CDS:
190..999

Additional Resources:

NCBI RefSeq record:
NM_009159.3
NBCI Gene record:
Srsf5 (20384)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009159.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437110 TTACGGACGGATCCGAGATAT pLKO_005 267 CDS 100% 13.200 18.480 N Srsf5 n/a
2 TRCN0000416421 TCCCAAACCATACTTGCTAAA pLKO_005 1049 3UTR 100% 10.800 15.120 N Srsf5 n/a
3 TRCN0000109057 CATCGACCTAAACTAAATGAA pLKO.1 607 CDS 100% 5.625 7.875 N Srsf5 n/a
4 TRCN0000412784 CGACTTATAGTTGAGAATTTA pLKO_005 514 CDS 100% 15.000 12.000 N Srsf5 n/a
5 TRCN0000418358 AGCTCTAAATTTGCTTGTATA pLKO_005 1381 3UTR 100% 13.200 10.560 N Srsf5 n/a
6 TRCN0000272565 CAGTTGACAGTGGCAATTAAA pLKO_005 980 CDS 100% 15.000 10.500 N SRSF5 n/a
7 TRCN0000417663 TGTGACTGTCTGAAGTATATA pLKO_005 1211 3UTR 100% 15.000 10.500 N Srsf5 n/a
8 TRCN0000423789 GGATGCAGATGATGCTGTTTA pLKO_005 333 CDS 100% 13.200 9.240 N Srsf5 n/a
9 TRCN0000412531 GTAGTTGAGTTTGCCTCTTAT pLKO_005 631 CDS 100% 13.200 9.240 N Srsf5 n/a
10 TRCN0000417579 GTGACTTAAAGAATGCTATTG pLKO_005 653 CDS 100% 10.800 7.560 N Srsf5 n/a
11 TRCN0000439526 TCACGAAGGAGCAAGTCTTAC pLKO_005 802 CDS 100% 10.800 7.560 N Srsf5 n/a
12 TRCN0000109059 AGAAACGTGGTTCTTCGAGTA pLKO.1 899 CDS 100% 4.050 2.835 N Srsf5 n/a
13 TRCN0000109058 GCAGGATCTCAAAGATTTCAT pLKO.1 552 CDS 100% 5.625 3.375 N Srsf5 n/a
14 TRCN0000000141 TGGAAGAGGTAGAGGACGATA pLKO.1 423 CDS 100% 4.950 2.970 N SRSF5 n/a
15 TRCN0000272624 TGGAAGAGGTAGAGGACGATA pLKO_005 423 CDS 100% 4.950 2.970 N SRSF5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009159.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01524 pDONR223 100% 92.4% 97.7% None (many diffs) n/a
2 ccsbBroad304_01524 pLX_304 0% 92.4% 97.7% V5 (many diffs) n/a
3 TRCN0000471422 CTGGATAAACTCTTTCAAATCTAA pLX_317 39.7% 92.4% 97.7% V5 (many diffs) n/a
Download CSV