Transcript: Human XM_017021593.2

PREDICTED: Homo sapiens serine and arginine rich splicing factor 5 (SRSF5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRSF5 (6430)
Length:
1615
CDS:
256..1071

Additional Resources:

NCBI RefSeq record:
XM_017021593.2
NBCI Gene record:
SRSF5 (6430)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021593.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272623 CGGATGCACACCGACCTAAAT pLKO_005 665 CDS 100% 13.200 18.480 N SRSF5 n/a
2 TRCN0000416421 TCCCAAACCATACTTGCTAAA pLKO_005 1127 3UTR 100% 10.800 15.120 N Srsf5 n/a
3 TRCN0000000142 CTGTGTATGAGCTTGATGGAA pLKO.1 413 CDS 100% 3.000 4.200 N SRSF5 n/a
4 TRCN0000272565 CAGTTGACAGTGGCAATTAAA pLKO_005 1052 CDS 100% 15.000 10.500 N SRSF5 n/a
5 TRCN0000272564 ATAAGCCTTCTGCTCACATTT pLKO_005 1275 3UTR 100% 13.200 9.240 N SRSF5 n/a
6 TRCN0000284799 AGTAGTCGCAGACCTCGAAAT pLKO_005 523 CDS 100% 10.800 7.560 N SRSF5 n/a
7 TRCN0000417579 GTGACTTAAAGAATGCTATTG pLKO_005 719 CDS 100% 10.800 7.560 N Srsf5 n/a
8 TRCN0000109058 GCAGGATCTCAAAGATTTCAT pLKO.1 618 CDS 100% 5.625 3.938 N Srsf5 n/a
9 TRCN0000000141 TGGAAGAGGTAGAGGACGATA pLKO.1 489 CDS 100% 4.950 3.465 N SRSF5 n/a
10 TRCN0000272624 TGGAAGAGGTAGAGGACGATA pLKO_005 489 CDS 100% 4.950 3.465 N SRSF5 n/a
11 TRCN0000418358 AGCTCTAAATTTGCTTGTATA pLKO_005 1478 3UTR 100% 13.200 9.240 N Srsf5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021593.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01524 pDONR223 100% 99.6% 99.6% None 549_550insAGT n/a
2 ccsbBroad304_01524 pLX_304 0% 99.6% 99.6% V5 549_550insAGT n/a
3 TRCN0000471422 CTGGATAAACTCTTTCAAATCTAA pLX_317 39.7% 99.6% 99.6% V5 549_550insAGT n/a
Download CSV