Transcript: Human XM_011537077.3

PREDICTED: Homo sapiens serine and arginine rich splicing factor 5 (SRSF5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRSF5 (6430)
Length:
1427
CDS:
164..883

Additional Resources:

NCBI RefSeq record:
XM_011537077.3
NBCI Gene record:
SRSF5 (6430)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537077.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272623 CGGATGCACACCGACCTAAAT pLKO_005 474 CDS 100% 13.200 18.480 N SRSF5 n/a
2 TRCN0000416421 TCCCAAACCATACTTGCTAAA pLKO_005 939 3UTR 100% 10.800 15.120 N Srsf5 n/a
3 TRCN0000000142 CTGTGTATGAGCTTGATGGAA pLKO.1 321 CDS 100% 3.000 4.200 N SRSF5 n/a
4 TRCN0000272565 CAGTTGACAGTGGCAATTAAA pLKO_005 864 CDS 100% 15.000 10.500 N SRSF5 n/a
5 TRCN0000272564 ATAAGCCTTCTGCTCACATTT pLKO_005 1087 3UTR 100% 13.200 9.240 N SRSF5 n/a
6 TRCN0000417579 GTGACTTAAAGAATGCTATTG pLKO_005 528 CDS 100% 10.800 7.560 N Srsf5 n/a
7 TRCN0000109058 GCAGGATCTCAAAGATTTCAT pLKO.1 427 CDS 100% 5.625 3.938 N Srsf5 n/a
8 TRCN0000418358 AGCTCTAAATTTGCTTGTATA pLKO_005 1290 3UTR 100% 13.200 9.240 N Srsf5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537077.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01524 pDONR223 100% 87.8% 87.8% None 196_197ins99 n/a
2 ccsbBroad304_01524 pLX_304 0% 87.8% 87.8% V5 196_197ins99 n/a
3 TRCN0000471422 CTGGATAAACTCTTTCAAATCTAA pLX_317 39.7% 87.8% 87.8% V5 196_197ins99 n/a
Download CSV