Construct: ORF TRCN0000471648
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010085.2_s317c1
- Derived from:
- ccsbBroadEn_15031
- DNA Barcode:
- CAATCTAAACGGTAAATCGTACAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TKFC (26007)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471648
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 26007 | TKFC | triokinase and FMN cyclase | NM_001351976.2 | 100% | 100% | |
| 2 | human | 26007 | TKFC | triokinase and FMN cyclase | NM_015533.4 | 100% | 100% | |
| 3 | human | 26007 | TKFC | triokinase and FMN cyclase | NM_001351978.1 | 93.6% | 91.2% | (many diffs) |
| 4 | human | 26007 | TKFC | triokinase and FMN cyclase | XM_017017519.2 | 92.5% | 89.6% | (many diffs) |
| 5 | human | 26007 | TKFC | triokinase and FMN cyclase | NM_001351979.2 | 92.5% | 91.3% | (many diffs) |
| 6 | human | 26007 | TKFC | triokinase and FMN cyclase | XM_017017517.1 | 92.4% | 92.4% | 1_139del;140_141insT |
| 7 | human | 26007 | TKFC | triokinase and FMN cyclase | NM_001351977.2 | 92% | 87.2% | (many diffs) |
| 8 | human | 26007 | TKFC | triokinase and FMN cyclase | XM_017017518.1 | 86.7% | 84.3% | (many diffs) |
| 9 | human | 26007 | TKFC | triokinase and FMN cyclase | XM_011544912.3 | 85.8% | 83% | (many diffs) |
| 10 | human | 26007 | TKFC | triokinase and FMN cyclase | XM_017017520.1 | 85.5% | 84.3% | (many diffs) |
| 11 | human | 26007 | TKFC | triokinase and FMN cyclase | NM_001351980.2 | 80.3% | 79.1% | (many diffs) |
| 12 | mouse | 225913 | Tkfc | triokinase, FMN cyclase | NM_145496.1 | 83.3% | 84.9% | (many diffs) |
| 13 | mouse | 225913 | Tkfc | triokinase, FMN cyclase | XM_006526942.2 | 83.3% | 84.9% | (many diffs) |
| 14 | mouse | 225913 | Tkfc | triokinase, FMN cyclase | XM_006526943.3 | 83.3% | 84.9% | (many diffs) |
| 15 | mouse | 225913 | Tkfc | triokinase, FMN cyclase | XM_006526944.3 | 83.3% | 84.9% | (many diffs) |
| 16 | mouse | 225913 | Tkfc | triokinase, FMN cyclase | XM_011247223.2 | 82.6% | 84.2% | (many diffs) |
| 17 | mouse | 225913 | Tkfc | triokinase, FMN cyclase | XM_006526941.3 | 76.4% | 77.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1791
- ORF length:
- 1725
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac ctccaagaag ctggtgaact cggtggctgg ctgtgctgat gacgctcttg 121 ctggcctggt ggcctgcaac cccaacctgc agctcctgca gggccaccgc gtggccctcc 181 gttctgacct ggacagcctc aagggccggg tggcactgct gtcgggtggg ggctctggcc 241 atgagcctgc ccatgctggt ttcataggga aggggatgct gactggggtc atcgcgggag 301 ctgtgttcac ctccccggca gtgggcagca tcctggcagc catcagggcc gtggcccagg 361 ccggcacagt ggggacgctc cttatcgtga agaactacac tggggatcgg ctcaacttcg 421 gcctggcccg ggagcaggcc cgggctgaag gcatcccggt ggagatggtg gtgattgggg 481 acgacagcgc cttcactgtc ctgaagaagg caggccggcg ggggctgtgc ggcacggtgc 541 ttatacacaa ggtggcaggt gctctggctg aggctggtgt ggggctggag gagatcgcaa 601 agcaggtgaa cgtggtcgcc aaggccatgg gtaccctggg ggtgagctta tcctcctgca 661 gcgtccctgg ttccaaaccc accttcgagc tctcagccga cgaggtggag ctgggcctgg 721 ggatccacgg ggaagctggt gtgcgccgga taaagatggc aaccgccgat gagattgtga 781 aactcatgct cgaccacatg acaaacacca ccaacgcgtc ccatgtgcct gtgcagcccg 841 gctcctcagt tgtgatgatg gtcaacaacc tgggtggcct gtcattcctg gaactgggca 901 tcatagccga cgctaccgtc cgctccctgg agggccgcgg ggtgaagatt gcccgtgccc 961 tggtgggcac cttcatgtca gcactggaga tgcctggcat ttctctcacc ctcctgctgg 1021 tggatgagcc tctcctgaaa ctgatagatg ctgaaaccac tgcagcagcc tggcctaacg 1081 tggctgcagt ctccattact gggcggaagc ggagccgggt agcccctgcc gagccccagg 1141 aggcccctga ttccactgct gcaggaggct cagcctcgaa gcggatggcg ctggtgctgg 1201 aacgggtgtg cagcactctc ctgggcctgg aggaacacct gaatgccctg gaccgggctg 1261 ctggtgacgg cgactgtggc accacccaca gccgtgcggc cagagcaatc caggagtggc 1321 tgaaggaggg cccaccccct gccagccctg cccagctgct ctccaagttg tctgtcctgc 1381 TCCTGGAGAA GATGGGAGGC TCATCTGGGG CGCTCTATGG CCTGTTCCTG ACTGCGGCTG 1441 CACAGCCCCT GAAGGCCAAG ACCAGCCTCC CAGCCTGGTC TGCTGCCATG GATGCCGGCC 1501 TGGAAGCCAT GCAGAAGTAT GGCAAGGCTG CTCCAGGGGA CAGGACTATG CTGGATTCTC 1561 TGTGGGCAGC GGGGCAGGAG CTCCAAGCCT GGAAGAGCCC AGGAGCTGAT CTGTTACAAG 1621 TCCTGACCAA AGCAGTCAAG AGTGCCGAAG CTGCAGCCGA GGCCACCAAG AATATGGAAG 1681 CTGGAGCCGG AAGAGCCAGT TATATCAGCT CAGCACGGCT GGAGCAGCCA GACCCCGGGG 1741 CGGTGGCAGC TGCTGCCATC CTCCGGGCCA TCTTGGAGGT CTTGCAGAGC TACCCAACTT 1801 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1861 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1921 CTTGTGGAAA GGACGACAAT CTAAACGGTA AATCGTACAT ACGCGTTAAG TCgacaatca 1981 acctctggat tacaaaattt gtgaaagatt