Transcript: Human XM_017017517.1

PREDICTED: Homo sapiens triokinase and FMN cyclase (TKFC), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TKFC (26007)
Length:
5459
CDS:
1338..3203

Additional Resources:

NCBI RefSeq record:
XM_017017517.1
NBCI Gene record:
TKFC (26007)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078622 CCTCTCCTGAAACTGATAGAT pLKO.1 2439 CDS 100% 5.625 3.938 N TKFC n/a
2 TRCN0000300769 CCTCTCCTGAAACTGATAGAT pLKO_005 2439 CDS 100% 5.625 3.938 N TKFC n/a
3 TRCN0000078618 CCCTCTAAGTTGAGCAGGAAA pLKO.1 3320 3UTR 100% 4.950 3.465 N TKFC n/a
4 TRCN0000300847 CCCTCTAAGTTGAGCAGGAAA pLKO_005 3320 3UTR 100% 4.950 3.465 N TKFC n/a
5 TRCN0000078621 CTGTTACAAGTCCTGACCAAA pLKO.1 3021 CDS 100% 4.950 3.465 N TKFC n/a
6 TRCN0000078620 GCTCCTTATCGTGAAGAACTA pLKO.1 1787 CDS 100% 4.950 3.465 N TKFC n/a
7 TRCN0000300802 GCTCCTTATCGTGAAGAACTA pLKO_005 1787 CDS 100% 4.950 3.465 N TKFC n/a
8 TRCN0000078619 CCACATGACAAACACCACCAA pLKO.1 2204 CDS 100% 2.640 1.848 N TKFC n/a
9 TRCN0000300846 CCACATGACAAACACCACCAA pLKO_005 2204 CDS 100% 2.640 1.848 N TKFC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15031 pDONR223 0% 92.4% 92.4% None 1_139del;140_141insT n/a
2 ccsbBroad304_15031 pLX_304 0% 92.4% 92.4% V5 1_139del;140_141insT n/a
3 TRCN0000471648 CAATCTAAACGGTAAATCGTACAT pLX_317 24.1% 92.4% 92.4% V5 1_139del;140_141insT n/a
4 TRCN0000488807 GTGTGGAACAGGCCGCTTTAATGG pLX_317 20.2% 92.4% 92.4% V5 (not translated due to prior stop codon) 1_139del;140_141insT n/a
5 ccsbBroadEn_14101 pDONR223 100% 92.4% 91.9% None 1_139del;140_141insT;1857delG n/a
6 ccsbBroad304_14101 pLX_304 0% 92.4% 91.9% V5 (not translated due to frame shift) 1_139del;140_141insT;1857delG n/a
7 TRCN0000480040 CACTACCGCCGCATCTCTTGGGCA pLX_317 6.4% 92.4% 91.9% V5 (not translated due to frame shift) 1_139del;140_141insT;1857delG n/a
Download CSV