Transcript: Mouse XM_006526941.3

PREDICTED: Mus musculus triokinase, FMN cyclase (Tkfc), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tkfc (225913)
Length:
2348
CDS:
25..1917

Additional Resources:

NCBI RefSeq record:
XM_006526941.3
NBCI Gene record:
Tkfc (225913)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526941.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378410 AGCTGGTGTTCGTCGGATAAA pLKO_005 849 CDS 100% 13.200 18.480 N Tkfc n/a
2 TRCN0000025353 GTGCTGGGAGAGCTAGTTATA pLKO.1 1799 CDS 100% 13.200 18.480 N Tkfc n/a
3 TRCN0000025349 CCCGTGCTGAAGCTAATAGAT pLKO.1 1144 CDS 100% 5.625 4.500 N Tkfc n/a
4 TRCN0000362012 GGTGCTGGGAGAGCTAGTTAT pLKO_005 1798 CDS 100% 13.200 9.240 N Tkfc n/a
5 TRCN0000368827 CTAACTGGGTATACCCATTTC pLKO_005 2174 3UTR 100% 10.800 7.560 N Tkfc n/a
6 TRCN0000025350 GCCTGGTGTGTCTCTTACTTT pLKO.1 1107 CDS 100% 5.625 3.938 N Tkfc n/a
7 TRCN0000025351 CCACATGACAAACACCTCCAA pLKO.1 909 CDS 100% 2.640 1.848 N Tkfc n/a
8 TRCN0000025352 GCTCAACTTTGGACTTGCCAT pLKO.1 525 CDS 100% 2.640 1.848 N Tkfc n/a
9 TRCN0000061135 CCTTCAGAACTGTTCCATGAA pLKO.1 2059 3UTR 100% 4.950 2.970 N CHRNA5 n/a
10 TRCN0000291261 CCTTCAGAACTGTTCCATGAA pLKO_005 2059 3UTR 100% 4.950 2.970 N CHRNA5 n/a
11 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 2234 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526941.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15031 pDONR223 0% 76.4% 77.9% None (many diffs) n/a
2 ccsbBroad304_15031 pLX_304 0% 76.4% 77.9% V5 (many diffs) n/a
3 TRCN0000471648 CAATCTAAACGGTAAATCGTACAT pLX_317 24.1% 76.4% 77.9% V5 (many diffs) n/a
4 TRCN0000488807 GTGTGGAACAGGCCGCTTTAATGG pLX_317 20.2% 76.4% 77.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV