Construct: ORF TRCN0000471653
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018980.3_s317c1
- Derived from:
- ccsbBroadEn_14901
- DNA Barcode:
- TATAACTGCTAGCAGGATTGGGAT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- CAMK1 (8536)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471653
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | NM_003656.5 | 99.4% | 62.9% | (many diffs) |
| 2 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XM_005265516.2 | 89.1% | 56.4% | (many diffs) |
| 3 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XM_017007354.1 | 87.5% | 51% | (many diffs) |
| 4 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XM_024453796.1 | 82.7% | 46.2% | (many diffs) |
| 5 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XM_005265517.3 | 78.4% | 45.7% | (many diffs) |
| 6 | human | 8536 | CAMK1 | calcium/calmodulin dependen... | XR_940505.2 | 68.6% | (many diffs) | |
| 7 | mouse | 52163 | Camk1 | calcium/calmodulin-dependen... | NM_133926.2 | 89.3% | 61.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 780
- ORF length:
- 711
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gctgggggca gtggaaggcc ccaggtggaa gcaggcggag gacattagag 121 acatctacga cttccgagat gttctgggca cgggggcctt ctcggaggtg atcctggcag 181 aagataagag gacgcagaag ctggtggcca tcaaatgcat tgccaaggag gccctggagg 241 gcaaggaagg cagcatggag aatgagattg ctgtcctgca caagatcaag caccccaaca 301 ttgtagccct ggatgacatc tatgagagtg ggggccacct ctacctcatc atgcagctgg 361 tgtcgggtgg ggagctcttt gaccgtattg tggaaaaagg cttctacacg gagcgggacg 421 ccagccgcct catcttccag gtgctggatg ctgtgaaata cctgcntgac ntgggcattg 481 tacaccggga tctcaagcca gagaatctgc tgtactacag ccnggatgaa gactccaaaa 541 tcatgatctc cgactttggc ctctccaaga tggaggaccc gggcagtgtg ctctccaccg 601 cctgtggaac tccgggatac gtggcccctg aagtcctggc ccagaagccc tacagcaagg 661 ctgtggattg ctggtccata ggtgtcatcg cctacatctt gctctgcggt taccctccct 721 tctatgacga gaatgatgcc aaactctttn nacagatttt gaaggccgag tacgagtttt 781 gactctcctt actgggacga caTCTCTGAC TCTGCCAAAG ATTTCATCCG GCACTTGATG 841 GAGAAGGACC CAGAGAAAAG ATTCACCTGT GAGCAGGCCT TGCAGCACCC ATGGATTGCA 901 GGAGATACAG CTCTAGATAA GAATATCCAC CAGTCGGTGA GTGAGCAGAT CAAGAAGAAC 961 TTTGCCAAGA GCAAGTGGAA GCAAGCCTTC AATGCCACGG CTGTGGTGCG GCACATGAGG 1021 AAACTGCAGC TGGGCACCAG CCAGGAGGGG CAGGGGCAGA CGGCGAGCCA TGGGGAGCTG 1081 CTGACACCAG TGGCTGGGGG GCCGGCAGCT GGCTGTTGCT GTCGAGACTG CTGCGTGGAG 1141 CCGGGCACAG AACTGTCCCC CACACTGCCC CACCAGCTCT TGCCAACTTT CTTGTACAAA 1201 GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA 1261 TGAACTAGTC CGTAACTTGA AAGTATATCG ATTTCTTGGC TTTATATATC TTGTGGAAAG 1321 GACGATATAA CTGCTAGCAG GATTGGGATA CGCGTTAAGT Cgacaatcaa cctctggatt 1381 acaaaatttg tgaaagatt