Construct: ORF TRCN0000471695
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000431.1_s317c1
- Derived from:
- ccsbBroadEn_11334
- DNA Barcode:
- CCAGCCTATGATCGCTAAACGGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MTA1 (9112)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471695
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9112 | MTA1 | metastasis associated 1 | XM_017021759.1 | 38.7% | 38.6% | 1_1134del;1588G>A;1749_1820del |
| 2 | human | 9112 | MTA1 | metastasis associated 1 | XM_017021758.2 | 35% | 34.9% | 1_1341del;1795G>A;1956_2027del |
| 3 | human | 9112 | MTA1 | metastasis associated 1 | NM_004689.4 | 34.8% | 34.7% | 1_1392del;1811_1812insGGGCACTTACCT;1834G>A |
| 4 | human | 9112 | MTA1 | metastasis associated 1 | XM_017021757.2 | 34.2% | 34.1% | 1_1392del;1846G>A;2007_2078del |
| 5 | human | 9112 | MTA1 | metastasis associated 1 | XM_011537308.2 | 33.5% | 33.5% | 1_1509del;1963G>A |
| 6 | human | 9112 | MTA1 | metastasis associated 1 | XM_011537309.1 | 33% | 32.9% | 1_1509del;1928_1929insGGGCACTTACCT;1951G>A |
| 7 | human | 9112 | MTA1 | metastasis associated 1 | XM_017021756.1 | 32.9% | 32.9% | 1_1479del;1933G>A;2094_2165del |
| 8 | human | 9112 | MTA1 | metastasis associated 1 | XM_011537305.1 | 32.8% | 32.7% | 1_1560del;2014G>A |
| 9 | human | 9112 | MTA1 | metastasis associated 1 | XM_017021755.2 | 32.5% | 32.4% | 1_1509del;1963G>A;2124_2195del |
| 10 | human | 9112 | MTA1 | metastasis associated 1 | XM_011537306.1 | 32.3% | 32.2% | 1_1560del;1979_1980insGGGCACTTACCT;2002G>A |
| 11 | human | 9112 | MTA1 | metastasis associated 1 | XM_017021752.1 | 31.8% | 31.7% | 1_1560del;2014G>A;2175_2246del |
| 12 | human | 9112 | MTA1 | metastasis associated 1 | XM_011537310.1 | 31.4% | 31.3% | 1_1509del;1893_1894ins48;1915G>A |
| 13 | human | 9112 | MTA1 | metastasis associated 1 | XM_017021753.2 | 31.3% | 31.2% | (many diffs) |
| 14 | human | 9112 | MTA1 | metastasis associated 1 | XM_011537307.1 | 30.7% | 30.7% | 1_1560del;1944_1945ins48;1966G>A |
| 15 | human | 9112 | MTA1 | metastasis associated 1 | XM_017021754.2 | 29.8% | 29.7% | (many diffs) |
| 16 | human | 9112 | MTA1 | metastasis associated 1 | XR_001750593.1 | 26.7% | (many diffs) | |
| 17 | human | 9112 | MTA1 | metastasis associated 1 | XR_001750594.1 | 25.4% | (many diffs) | |
| 18 | human | 9112 | MTA1 | metastasis associated 1 | XR_002957571.1 | 24.2% | (many diffs) | |
| 19 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_006515428.2 | 32.5% | 35.7% | (many diffs) |
| 20 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_006515427.1 | 32.4% | 35.6% | (many diffs) |
| 21 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_006515429.2 | 31.9% | 35.1% | (many diffs) |
| 22 | mouse | 116870 | Mta1 | metastasis associated 1 | NM_054081.2 | 31.8% | 35% | (many diffs) |
| 23 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_006515423.2 | 31.8% | 34.9% | (many diffs) |
| 24 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_006515421.1 | 31.7% | 34.8% | (many diffs) |
| 25 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_006515420.1 | 31.6% | 34.7% | (many diffs) |
| 26 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_006515424.2 | 31.1% | 34.3% | (many diffs) |
| 27 | mouse | 116870 | Mta1 | metastasis associated 1 | XR_381476.1 | 31.1% | (many diffs) | |
| 28 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_006515422.1 | 31.1% | 34.2% | (many diffs) |
| 29 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_017314939.1 | 31.1% | 34.1% | (many diffs) |
| 30 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_006515418.1 | 31% | 34% | (many diffs) |
| 31 | mouse | 116870 | Mta1 | metastasis associated 1 | XR_381475.1 | 30.5% | (many diffs) | |
| 32 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_006515419.1 | 30.4% | 33.5% | (many diffs) |
| 33 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_006515431.2 | 30.2% | 33.4% | (many diffs) |
| 34 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_006515430.1 | 30.1% | 33.3% | (many diffs) |
| 35 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_006515425.1 | 29.9% | 33.1% | (many diffs) |
| 36 | mouse | 116870 | Mta1 | metastasis associated 1 | XR_381473.1 | 29.8% | (many diffs) | |
| 37 | mouse | 116870 | Mta1 | metastasis associated 1 | NM_001346696.1 | 29.4% | 32.5% | (many diffs) |
| 38 | mouse | 116870 | Mta1 | metastasis associated 1 | XR_001780412.1 | 25.8% | (many diffs) | |
| 39 | mouse | 116870 | Mta1 | metastasis associated 1 | XM_011243988.1 | 22.7% | 21.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 831
- ORF length:
- 765
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gaccaggcag gctttctatc tgcacacgac gaagctgacg cggatcgccc 121 ggcgcctgtg ccgtgagatc ctgcgcccgt ggcacgctgc gcggcacccc tacctgccca 181 tcaacagcgc ggccatcaag gccgagtgca cggcgcggct gcccgaagcc tcccagagcc 241 cgctggtgct gaagcaggcg gtacgcaagc cgctggaagc cgtgcttcgg tatcttgaga 301 cccacccccg cccccccaag cctgaccccg tgaaaagcgt gtccagcgtg ctcagcagcc 361 tgacgcccgc caaggtggcc cccgtcatca acaacggctc ccccaccaTC CTGGGCAAGC 421 GCAGCTACGA GCAGCACAAC GGGGTGGACG GCAACATGAA GAAGCGCCTC TTGATGCCCA 481 GTAGGGGCAC TTACCTGGGT CTGGCAAACC ACGGACAGAC CAGGCACATG GGACCAAGCC 541 GGAACCTCCT GCTCAACGGG AAGTCCTACC CCACCAAAGT GCGCCTGATC CGGGGGGGCT 601 CCCTGCCCCC AGTCAAGCGG CGGCGGATGA ACTGGATCGA CGCCCCGGAT GACGTGTTCT 661 ACATGGCCAC AGAGGAGACC AGGAAGATCC GCAAGCTGCT CTCATCCTCG GAAACCAAGC 721 GTGCTGCCCG CCGGCCCTAC AAGCCCATCG CCCTGCGCCA GAGCCAGGCC CTGCCGCCGC 781 GGCCACCGCC ACCTGCGCCC GTCAACGACG AGCCCATCGT CATCGAGGAC TACCCAACTT 841 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 901 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 961 CTTGTGGAAA GGACGACCAG CCTATGATCG CTAAACGGTT ACGCGTTAAG TCgacaatca 1021 acctctggat tacaaaattt gtgaaagatt