Transcript: Human XR_002957571.1

PREDICTED: Homo sapiens metastasis associated 1 (MTA1), transcript variant X17, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTA1 (9112)
Length:
3152
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957571.1
NBCI Gene record:
MTA1 (9112)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230495 CCATACCTGATCCGGAGAATC pLKO_005 244 3UTR 100% 10.800 15.120 N MTA1 n/a
2 TRCN0000013358 CGGCTAACTTATTCCGAGAAT pLKO.1 2803 3UTR 100% 4.950 6.930 N MTA1 n/a
3 TRCN0000280439 CGGCTAACTTATTCCGAGAAT pLKO_005 2803 3UTR 100% 4.950 6.930 N MTA1 n/a
4 TRCN0000230497 TGCGCATCTTGTTGGACATAT pLKO_005 1385 3UTR 100% 13.200 10.560 N MTA1 n/a
5 TRCN0000013360 CCCAACTATAACAAGCCAAAT pLKO.1 1252 3UTR 100% 10.800 8.640 N MTA1 n/a
6 TRCN0000218670 AGACATCACCGACTTGTTAAA pLKO_005 708 3UTR 100% 13.200 9.240 N MTA1 n/a
7 TRCN0000013362 GCGCATCTTGTTGGACATATT pLKO.1 1386 3UTR 100% 13.200 9.240 N MTA1 n/a
8 TRCN0000230496 TGAAGCTGAGAGCAAGTTAAA pLKO_005 1218 3UTR 100% 13.200 9.240 N MTA1 n/a
9 TRCN0000230498 GGCTAACTTATTCCGAGAATG pLKO_005 2804 3UTR 100% 10.800 7.560 N MTA1 n/a
10 TRCN0000013359 GCGGGAGGATTTCTTCTTCTA pLKO.1 609 3UTR 100% 4.950 3.465 N MTA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957571.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11334 pDONR223 100% 24.2% None (many diffs) n/a
2 ccsbBroad304_11334 pLX_304 0% 24.2% V5 (many diffs) n/a
3 TRCN0000471695 CCAGCCTATGATCGCTAAACGGTT pLX_317 55.1% 24.2% V5 (many diffs) n/a
Download CSV