Transcript: Human XM_017021757.2

PREDICTED: Homo sapiens metastasis associated 1 (MTA1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTA1 (9112)
Length:
2865
CDS:
120..2351

Additional Resources:

NCBI RefSeq record:
XM_017021757.2
NBCI Gene record:
MTA1 (9112)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021757.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230495 CCATACCTGATCCGGAGAATC pLKO_005 180 CDS 100% 10.800 15.120 N MTA1 n/a
2 TRCN0000013358 CGGCTAACTTATTCCGAGAAT pLKO.1 2516 3UTR 100% 4.950 6.930 N MTA1 n/a
3 TRCN0000280439 CGGCTAACTTATTCCGAGAAT pLKO_005 2516 3UTR 100% 4.950 6.930 N MTA1 n/a
4 TRCN0000230497 TGCGCATCTTGTTGGACATAT pLKO_005 1368 CDS 100% 13.200 10.560 N MTA1 n/a
5 TRCN0000013360 CCCAACTATAACAAGCCAAAT pLKO.1 1188 CDS 100% 10.800 8.640 N MTA1 n/a
6 TRCN0000218670 AGACATCACCGACTTGTTAAA pLKO_005 644 CDS 100% 13.200 9.240 N MTA1 n/a
7 TRCN0000013362 GCGCATCTTGTTGGACATATT pLKO.1 1369 CDS 100% 13.200 9.240 N MTA1 n/a
8 TRCN0000230496 TGAAGCTGAGAGCAAGTTAAA pLKO_005 1154 CDS 100% 13.200 9.240 N MTA1 n/a
9 TRCN0000230498 GGCTAACTTATTCCGAGAATG pLKO_005 2517 3UTR 100% 10.800 7.560 N MTA1 n/a
10 TRCN0000013359 GCGGGAGGATTTCTTCTTCTA pLKO.1 545 CDS 100% 4.950 3.465 N MTA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021757.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11334 pDONR223 100% 34.2% 34.1% None 1_1392del;1846G>A;2007_2078del n/a
2 ccsbBroad304_11334 pLX_304 0% 34.2% 34.1% V5 1_1392del;1846G>A;2007_2078del n/a
3 TRCN0000471695 CCAGCCTATGATCGCTAAACGGTT pLX_317 55.1% 34.2% 34.1% V5 1_1392del;1846G>A;2007_2078del n/a
Download CSV