Construct: ORF TRCN0000471736
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007072.1_s317c1
- Derived from:
- ccsbBroadEn_05889
- DNA Barcode:
- CACGACCTATCCTGCTGATCAAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BGN (633)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471736
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 633 | BGN | biglycan | NM_001711.6 | 99.9% | 100% | 141G>A |
| 2 | human | 633 | BGN | biglycan | XM_017029724.2 | 99.9% | 100% | 141G>A |
| 3 | mouse | 12111 | Bgn | biglycan | NM_007542.5 | 88.4% | 95.6% | (many diffs) |
| 4 | mouse | 12111 | Bgn | biglycan | XM_006527758.3 | 84.9% | 91.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1170
- ORF length:
- 1104
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg gcccctgtgg cgcctcgtgt ctctgctggc cctgagccag gccctgccct 121 ttgagcagag aggcttctgg gacttcaccc tggacgatgg gccattcatg atgaacgatg 181 aggaagcttc gggcgctgac acctcaggcg tcctggaccc ggactctgtc acacccacct 241 acagcgccat gtgtcctttc ggctgccact gccacctgcg ggtggttcag tgctccgacc 301 tgggtctgaa gtctgtgccc aaagagatct cccctgacac cacgctgctg gacctgcaga 361 acaacgacat ctccgagctc cgcaaggatg acttcaaggg tctccagcac ctctacgccc 421 tcgtcctggt gaacaacaag atctccaaga tccatgagaa ggccttcagc ccactgcgga 481 agctgcagaa gctctacatc tccaagaacc acctggtgga gatcccgccc aacctaccca 541 gctccctggt ggagctccgc atccacgaca accgcatccg caaggtgccc aagggagtgt 601 tcagcgggct ccggaacatg aactgcatcg agatgggcgg gaacccactg gagaacagtg 661 gctttgaacc tggagccttc gatggcctga agctcaacta cctgcgcatc tcagaggcca 721 agctgactgg catccccaaa gacctcccTG AGACCCTGAA TGAACTCCAC CTAGACCACA 781 ACAAAATCCA GGCCATCGAA CTGGAGGACC TGCTTCGCTA CTCCAAGCTG TACAGGCTGG 841 GCCTAGGCCA CAACCAGATC AGGATGATCG AGAACGGGAG CCTGAGCTTC CTGCCCACCC 901 TCCGGGAGCT CCACTTGGAC AACAACAAGT TGGCCAGGGT GCCCTCAGGG CTCCCAGACC 961 TCAAGCTCCT CCAGGTGGTC TATCTGCACT CCAACAACAT CACCAAAGTG GGTGTCAACG 1021 ACTTCTGTCC CATGGGCTTC GGGGTGAAGC GGGCCTACTA CAACGGCATC AGCCTCTTCA 1081 ACAACCCCGT GCCCTACTGG GAGGTGCAGC CGGCCACTTT CCGCTGCGTC ACTGACCGCC 1141 TGGCCATCCA GTTTGGCAAC TACAAAAAGT ACCCAACTTT CTTGTACAAA GTGGTTGATA 1201 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1261 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACACGA 1321 CCTATCCTGC TGATCAAACA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1381 tgaaagatt