Construct: ORF TRCN0000471739
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006973.1_s317c1
- Derived from:
- ccsbBroadEn_04176
- DNA Barcode:
- ACAAACCTAGATTATCTAGCTGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- UXS1 (80146)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471739
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | NM_025076.4 | 100% | 100% | |
| 2 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | NM_001253875.1 | 98.8% | 98.8% | 121_135del |
| 3 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | XM_011511903.2 | 94% | 91.8% | (many diffs) |
| 4 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | XM_011511902.2 | 92.9% | 90.8% | (many diffs) |
| 5 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | XM_017005009.1 | 87.1% | 87.1% | 967_968ins162 |
| 6 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | XM_017005008.1 | 86.1% | 86.1% | 121_135del;982_983ins162 |
| 7 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | XM_011511904.3 | 86% | 82.7% | (many diffs) |
| 8 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | XM_017005010.1 | 85% | 80.6% | 1025_1026ins104;1071_1072ins85 |
| 9 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | XM_006712775.4 | 84% | 79.6% | 121_135del;1040_1041ins104;1086_1087ins85 |
| 10 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | XM_017005011.2 | 81.4% | 75.5% | (many diffs) |
| 11 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | XM_017005012.2 | 81.4% | 75.5% | (many diffs) |
| 12 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | XM_017005013.2 | 74.2% | 74.2% | 0_1ins324 |
| 13 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | NM_001253876.1 | 60% | 60% | 0_1ins504 |
| 14 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | XM_017005014.2 | 60% | 60% | 0_1ins504 |
| 15 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | XM_024453157.1 | 60% | 60% | 0_1ins504 |
| 16 | human | 80146 | UXS1 | UDP-glucuronate decarboxyla... | NR_045607.1 | 57.6% | 1_98del;217_218ins49;1310_2053del | |
| 17 | mouse | 67883 | Uxs1 | UDP-glucuronate decarboxyla... | NM_026430.3 | 89.1% | 98.5% | (many diffs) |
| 18 | mouse | 67883 | Uxs1 | UDP-glucuronate decarboxyla... | XM_006496227.3 | 88% | 97.4% | (many diffs) |
| 19 | mouse | 67883 | Uxs1 | UDP-glucuronate decarboxyla... | XM_006496228.3 | 52.9% | 59.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1326
- ORF length:
- 1260
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gagcaaggcg ctgctgcgcc tcgtgtctgc cgtcaaccgc aggaggatga 121 agctgctgct gggcatcgcc ttgctggcct acgtcgcctc tgtttggggc aacttcgtta 181 atatgaggtc tatccaggaa aatggtgaac taaaaattga aagcaagatt gaagagatgg 241 ttgaaccact aagagagaaa atcagagatt tagaaaaaag ctttacccag aaatacccac 301 cagtaaagtt tttatcagaa aaggatcgga aaagaatttt gataacagga ggcgcagggt 361 tcgtgggctc ccatctaact gacaaactca tgatggacgg ccacgaggtg accgtggtgg 421 acaatttctt cacgggcagg aagagaaacg tggagcactg gatcggacat gagaacttcg 481 agttgattaa ccacgacgtg gtggagcccc tctacatcga ggttgaccag atataccatc 541 tggcatctcc agcctcccct ccaaactaca tgtataatcc tatcaagaca ttaaagacca 601 atacgattgg gacattaaac atgttggggc tggcaaaacg agtcggtgcc cgtctgctcc 661 tggcctccac atcggaggtg tatggagatc ctgaagtcca ccctcaaagt gaggattact 721 ggggccacgt gaatccaata ggacctcggg cctgctacga tgaaggcaaa cgtgttgcag 781 agaccatgtg ctatgcctac atgaagcagg aaggcgtgga agtgcgagtg gccagaaTCT 841 TCAACACCTT TGGGCCACGC ATGCACATGA ACGATGGGCG AGTAGTCAGC AACTTCATCC 901 TGCAGGCGCT CCAGGGGGAG CCACTCACGG TATACGGATC CGGGTCTCAG ACAAGGGCGT 961 TCCAGTACGT CAGCGATCTA GTGAATGGCC TCGTGGCTCT CATGAACAGC AACGTCAGCA 1021 GCCCGGTCAA CCTGGGGAAC CCAGAAGAAC ACACAATCCT AGAATTTGCT CAGTTAATTA 1081 AAAACCTTGT TGGTAGCGGA AGTGAAATTC AGTTTCTCTC CGAAGCCCAG GATGACCCAC 1141 AGAAAAGAAA ACCAGACATC AAAAAAGCAA AGCTGATGCT GGGGTGGGAG CCCGTGGTCC 1201 CGCTGGAGGA AGGTTTAAAC AAAGCAATTC ACTACTTCCG TAAAGAACTC GAGTACCAGG 1261 CAAATAATCA GTACATCCCC AAACCAAAGC CTGCCAGAAT AAAGAAAGGA CGGACTCGCC 1321 ACAGCTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1381 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1441 CTTGGCTTTA TATATCTTGT GGAAAGGACG AACAAACCTA GATTATCTAG CTGTCACGCG 1501 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt