Transcript: Human XM_017005012.2

PREDICTED: Homo sapiens UDP-glucuronate decarboxylase 1 (UXS1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UXS1 (80146)
Length:
2121
CDS:
331..1398

Additional Resources:

NCBI RefSeq record:
XM_017005012.2
NBCI Gene record:
UXS1 (80146)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078492 CCCAGAAATACCCACCAGTAA pLKO.1 251 5UTR 100% 4.950 6.930 N UXS1 n/a
2 TRCN0000315775 CCCAGAAATACCCACCAGTAA pLKO_005 251 5UTR 100% 4.950 6.930 N UXS1 n/a
3 TRCN0000078491 CCTCCAAACTACATGTATAAT pLKO.1 628 CDS 100% 15.000 12.000 N UXS1 n/a
4 TRCN0000315772 CCTCCAAACTACATGTATAAT pLKO_005 628 CDS 100% 15.000 12.000 N UXS1 n/a
5 TRCN0000078490 CCAGGCAAATAATCAGTACAT pLKO.1 1326 CDS 100% 4.950 3.960 N UXS1 n/a
6 TRCN0000315773 CCAGGCAAATAATCAGTACAT pLKO_005 1326 CDS 100% 4.950 3.960 N UXS1 n/a
7 TRCN0000078489 CCACCCTCAAAGTGAGGATTA pLKO.1 768 CDS 100% 10.800 7.560 N UXS1 n/a
8 TRCN0000315853 CCACCCTCAAAGTGAGGATTA pLKO_005 768 CDS 100% 10.800 7.560 N UXS1 n/a
9 TRCN0000078488 GCTTGCTTTAATGAAATGGAT pLKO.1 1529 3UTR 100% 3.000 2.100 N UXS1 n/a
10 TRCN0000315771 GCTTGCTTTAATGAAATGGAT pLKO_005 1529 3UTR 100% 3.000 2.100 N UXS1 n/a
11 TRCN0000114479 GAAAGCAAGATTGAAGAGATT pLKO.1 184 5UTR 100% 4.950 3.465 N Uxs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005012.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04176 pDONR223 100% 81.4% 75.5% None (many diffs) n/a
2 ccsbBroad304_04176 pLX_304 0% 81.4% 75.5% V5 (many diffs) n/a
3 TRCN0000471739 ACAAACCTAGATTATCTAGCTGTC pLX_317 38.9% 81.4% 75.5% V5 (many diffs) n/a
Download CSV