Transcript: Mouse XM_006496227.3

PREDICTED: Mus musculus UDP-glucuronate decarboxylase 1 (Uxs1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Uxs1 (67883)
Length:
3770
CDS:
112..1389

Additional Resources:

NCBI RefSeq record:
XM_006496227.3
NBCI Gene record:
Uxs1 (67883)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496227.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305364 TGGAATTTGCTCAGTTAATTA pLKO_005 1121 CDS 100% 15.000 21.000 N Uxs1 n/a
2 TRCN0000305305 ACGTAAGTGATCTGGTGAATG pLKO_005 1028 CDS 100% 10.800 15.120 N Uxs1 n/a
3 TRCN0000305366 GGCCGAGAATGCACATGAATG pLKO_005 914 CDS 100% 10.800 15.120 N Uxs1 n/a
4 TRCN0000114477 CCAGGCTAATAACCAGTACAT pLKO.1 1317 CDS 100% 4.950 6.930 N Uxs1 n/a
5 TRCN0000114479 GAAAGCAAGATTGAAGAGATT pLKO.1 280 CDS 100% 4.950 3.465 N Uxs1 n/a
6 TRCN0000114478 GCAAGGATCTTCAACACCTTT pLKO.1 892 CDS 100% 4.950 3.465 N Uxs1 n/a
7 TRCN0000351219 GCAAGGATCTTCAACACCTTT pLKO_005 892 CDS 100% 4.950 3.465 N Uxs1 n/a
8 TRCN0000114476 GCTGAGAAGAACACTTGAGAT pLKO.1 2147 3UTR 100% 4.950 3.465 N Uxs1 n/a
9 TRCN0000114480 CGAAAGCAAGATTGAAGAGAT pLKO.1 279 CDS 100% 4.950 2.970 N Uxs1 n/a
10 TRCN0000349301 CGAAAGCAAGATTGAAGAGAT pLKO_005 279 CDS 100% 4.950 2.970 N Uxs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496227.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04176 pDONR223 100% 88% 97.4% None (many diffs) n/a
2 ccsbBroad304_04176 pLX_304 0% 88% 97.4% V5 (many diffs) n/a
3 TRCN0000471739 ACAAACCTAGATTATCTAGCTGTC pLX_317 38.9% 88% 97.4% V5 (many diffs) n/a
Download CSV