Construct: ORF TRCN0000471767
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009784.1_s317c1
- Derived from:
- ccsbBroadEn_10577
- DNA Barcode:
- CGCATACCATGCTAGACAACAGTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PIP5K1P1 (206426)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471767
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_003557.3 | 86.1% | 82.1% | (many diffs) |
| 2 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001330689.2 | 85.9% | 82% | (many diffs) |
| 3 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001135637.2 | 85.6% | 75.4% | (many diffs) |
| 4 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_017002440.1 | 85.2% | 80.7% | (many diffs) |
| 5 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_017002439.1 | 85% | 80.5% | (many diffs) |
| 6 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245528.5 | 84.4% | 80.5% | (many diffs) |
| 7 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245527.4 | 84.2% | 80.4% | (many diffs) |
| 8 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001135638.2 | 84.1% | 80.2% | (many diffs) |
| 9 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711564.4 | 84.1% | 80.2% | (many diffs) |
| 10 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245532.4 | 82.8% | 77.9% | (many diffs) |
| 11 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245525.5 | 82.6% | 78.8% | (many diffs) |
| 12 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711563.4 | 82.4% | 78.6% | (many diffs) |
| 13 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510046.3 | 81.8% | 78.7% | (many diffs) |
| 14 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510043.3 | 81.6% | 76.2% | (many diffs) |
| 15 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_024450130.1 | 81.5% | 76.3% | (many diffs) |
| 16 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245530.5 | 81.1% | 76.3% | (many diffs) |
| 17 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001135636.2 | 81% | 77.1% | (many diffs) |
| 18 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711567.4 | 81% | 76.8% | (many diffs) |
| 19 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510048.3 | 81% | 76.8% | (many diffs) |
| 20 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510049.3 | 81% | 76.8% | (many diffs) |
| 21 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_017002441.2 | 81% | 76.8% | (many diffs) |
| 22 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_024450131.1 | 80.6% | 77.2% | (many diffs) |
| 23 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510045.3 | 80% | 77% | (many diffs) |
| 24 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711568.4 | 79.9% | 74.6% | (many diffs) |
| 25 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_024450129.1 | 79.8% | 74.7% | (many diffs) |
| 26 | human | 266971 | PIPSL | PIP5K1A and PSMD4 like (pse... | NR_002319.2 | 36.8% | (many diffs) | |
| 27 | human | 206426 | PIP5K1P1 | phosphatidylinositol-4-phos... | NR_027712.1 | 36.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1602
- ORF length:
- 1536
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gtcggcctcc tcccaaccgt cgttggcggt cggtttttca tcctttgatc 121 ccggggcccc ttcctgtacc gcatcctcag catctggaat cttgagcccc acggcatctg 181 aggtgcctta tgcctctggc atgcccatca agaaaacagg ccatcgaggt gtcgattcct 241 caggagagac aacatataaa aagacaacct caacagcctt gaaaggtgcc atccagttag 301 gcattactta cactgtgggg agcctgagta ccaaaccaga gcgtgatgtc ctcatgcaag 361 atttctacgt ggtggagagt atcttcttcc ccagtgaagg gagcaacctg acccctgctc 421 atcactacaa tgccttccgt ttcaagacct atgcgccggt tgccttccgc tactttcggg 481 agctatttgg tatcccgccc gatgattact tgtgctccct ctgcagtgag ccgctgattg 541 aactctgtag ctctggagct agtggttccc tgttctatgt gtccagcgac gatgaactca 601 ttattaagac actccaacat aaagaggcgg agtttctgca gaagctgctt ccaggatact 661 acttgaacct cagccagaac cctcggactt tgctgcctaa attctttgga ctgtactgtg 721 tgcagacagg tggcaagaac attcggattg tggtgatgaa caatctttta ccaagatccg 781 tcaaaatgca tatcaaatat gacctcaaag gctcaaccta caaacgccgg gcttcccaga 841 aagagcgaga gaagcctctt cccacattta aagatctaga cttcttacaa gacatccctg 901 atggtctttt tttggatgct gacacgtaca atgctctctg taagaccctg cagcgtgact 961 gtttggtgct gcagagcttc aagataatgg actatagcct ctggctgtca atccacaata 1021 tagatcatgc acaacgagag cccttaagca gcgacactct tcaagtgtca atcgacactc 1081 aaagactggc tccccaaaag gctctgtatt ccacagccat ggaattcatc cagGGAGAGG 1141 CTCGGCTGGG CGACACCATG GAGGCCGATG ACCATATGGG TGGCATCCCT GCTCAGAATA 1201 GTAAAGGGGA AAGGCTTCTG CTTTATATTG GCATCATTGA CATTCTACAG TCTTACACGT 1261 TTCTTAAGAA GTTGGAGCAC TCTTGGAAAG CCGTGGTACA TGATGGGGAC GCTGTCTCAG 1321 TGCATCGCCC AGGCTTCTAC GCTGAACGGT TCCAGCACTT CATGTGCAAC GCAGTATTTA 1381 AGAAGATCCC CTTGAAGCCT TCTCCTTCCA AAAAGTTTCG GTCTGGCTTA TCTTTCTCTC 1441 TGCATACGGG CTCCAGTGGC AACTCCTGCA TTACTTACCA GCCACTGGTC TCTGAGGAAC 1501 ACAAGTCACA AGTGATAAAG GTGCAAGTGG AGCCAGGTGT TCACCTTGGT CGTTCTGATG 1561 TTTTACCTCA GACCTCAGAA TCCACCTTTG GAGGAAATCA GTGCCCAACT TTCTTGTACA 1621 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1681 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1741 AGGACGACGC ATACCATGCT AGACAACAGT GACGCGTTAA GTCgacaatc aacctctgga 1801 ttacaaaatt tgtgaaagat t