Transcript: Human NR_027712.1

Homo sapiens phosphatidylinositol-4-phosphate 5-kinase type 1 pseudogene 1 (PIP5K1P1), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
PIP5K1P1 (206426)
Length:
4243
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027712.1
NBCI Gene record:
PIP5K1P1 (206426)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231478 TCGGACTTTGCTGCCTAAATT pLKO_005 1053 3UTR 100% 15.000 7.500 Y PIP5K1A n/a
2 TRCN0000231480 AGTCAGAGTTCACCCATTAAG pLKO_005 2072 3UTR 100% 13.200 6.600 Y PIP5K1A n/a
3 TRCN0000196711 GATGTCCTCATGCAAGATTTC pLKO.1 715 3UTR 100% 10.800 5.400 Y PIP5K1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10577 pDONR223 100% 36.1% None (many diffs) n/a
2 ccsbBroad304_10577 pLX_304 0% 36.1% V5 (many diffs) n/a
3 TRCN0000471767 CGCATACCATGCTAGACAACAGTG pLX_317 30.7% 36.1% V5 (many diffs) n/a
4 ccsbBroadEn_07233 pDONR223 100% 33.1% None (many diffs) n/a
5 ccsbBroad304_07233 pLX_304 0% 33.1% V5 (many diffs) n/a
6 TRCN0000466603 ATCACCACTCATATCAAGTCGACA pLX_317 24.4% 33.1% V5 (many diffs) n/a
7 ccsbBroadEn_14891 pDONR223 0% 33.1% None (many diffs) n/a
8 ccsbBroad304_14891 pLX_304 0% 33.1% V5 (many diffs) n/a
9 TRCN0000488868 CCATATAGGAAATTTCAAACAAAT pLX_317 22.3% 33.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV