Transcript: Human NM_001135638.2

Homo sapiens phosphatidylinositol-4-phosphate 5-kinase type 1 alpha (PIP5K1A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PIP5K1A (8394)
Length:
3800
CDS:
446..2134

Additional Resources:

NCBI RefSeq record:
NM_001135638.2
NBCI Gene record:
PIP5K1A (8394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135638.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199304 CCCTCGTCTTTGACTAGGAAC pLKO.1 2492 3UTR 100% 4.050 2.835 N PIP5K1A n/a
2 TRCN0000195099 CGACGATGAGTTCATTATTAA pLKO.1 1006 CDS 100% 15.000 9.000 N PIP5K1A n/a
3 TRCN0000231481 ACAGACTAGCTGGCACATTAT pLKO_005 2534 3UTR 100% 13.200 7.920 N PIP5K1A n/a
4 TRCN0000231477 ATTAAGACAGTCCAACATAAA pLKO_005 1022 CDS 100% 13.200 7.920 N PIP5K1A n/a
5 TRCN0000024518 GCTTCCAGGATACTACATGAA pLKO.1 1066 CDS 100% 4.950 2.970 N Pip5k1a n/a
6 TRCN0000010129 AGCCCTGGTACATGACGGAGA pLKO.1 1705 CDS 100% 0.720 0.432 N PIP5K1A n/a
7 TRCN0000010128 GTTGATACTCGAAGACCGGCC pLKO.1 1487 CDS 100% 0.100 0.060 N PIP5K1A n/a
8 TRCN0000231478 TCGGACTTTGCTGCCTAAATT pLKO_005 1102 CDS 100% 15.000 7.500 Y PIP5K1A n/a
9 TRCN0000231480 AGTCAGAGTTCACCCATTAAG pLKO_005 2115 CDS 100% 13.200 6.600 Y PIP5K1A n/a
10 TRCN0000231479 CTCTTGATGTCAATCCATAAT pLKO_005 1418 CDS 100% 13.200 6.600 Y PIP5K1A n/a
11 TRCN0000195028 CCTCTTGATGTCAATCCATAA pLKO.1 1417 CDS 100% 10.800 5.400 Y PIP5K1A n/a
12 TRCN0000196711 GATGTCCTCATGCAAGATTTC pLKO.1 764 CDS 100% 10.800 5.400 Y PIP5K1A n/a
13 TRCN0000010142 ATAGGCCATAGAAGTGTTGAT pLKO.1 635 CDS 100% 4.950 2.475 Y PIP5K1A n/a
14 TRCN0000010138 TTTACCTCAGACTCCACCTTT pLKO.1 1981 CDS 100% 4.950 2.475 Y PIP5K1A n/a
15 TRCN0000010143 ATCCAGTTAGGCATTACCCAC pLKO.1 710 CDS 100% 2.160 1.080 Y PIP5K1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135638.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07233 pDONR223 100% 88.9% 88.9% None (many diffs) n/a
2 ccsbBroad304_07233 pLX_304 0% 88.9% 88.9% V5 (many diffs) n/a
3 TRCN0000466603 ATCACCACTCATATCAAGTCGACA pLX_317 24.4% 88.9% 88.9% V5 (many diffs) n/a
4 ccsbBroadEn_14891 pDONR223 0% 88.9% 88.9% None (many diffs) n/a
5 ccsbBroad304_14891 pLX_304 0% 88.9% 88.9% V5 (many diffs) n/a
6 TRCN0000488868 CCATATAGGAAATTTCAAACAAAT pLX_317 22.3% 88.9% 88.9% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_10577 pDONR223 100% 84.1% 80.2% None (many diffs) n/a
8 ccsbBroad304_10577 pLX_304 0% 84.1% 80.2% V5 (many diffs) n/a
9 TRCN0000471767 CGCATACCATGCTAGACAACAGTG pLX_317 30.7% 84.1% 80.2% V5 (many diffs) n/a
10 ccsbBroadEn_10588 pDONR223 100% 53.4% 51.5% None (many diffs) n/a
11 ccsbBroad304_10588 pLX_304 0% 53.4% 51.5% V5 (many diffs) n/a
12 TRCN0000479417 GACGAAACCCTTTCATATAAAGAT pLX_317 11.8% 53.4% 51.5% V5 (many diffs) n/a
Download CSV