Transcript: Human NM_001330689.2

Homo sapiens phosphatidylinositol-4-phosphate 5-kinase type 1 alpha (PIP5K1A), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
PIP5K1A (8394)
Length:
3764
CDS:
446..2098

Additional Resources:

NCBI RefSeq record:
NM_001330689.2
NBCI Gene record:
PIP5K1A (8394)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145606 GATGCTTACCAAGTAATCAT pXPR_003 CGG 442 27% 5 0.8011 PIP5K1A PIP5K1A 77961
2 BRDN0001487080 GTTAGGCATTACCCACACTG pXPR_003 TGG 250 15% 4 0.7261 PIP5K1A, PIPSL PIP5K1A 77962
3 BRDN0001147420 GACAGTCCAACATAAAGAGG pXPR_003 CGG 562 34% 6 0.4108 PIP5K1A PIP5K1A 77964
4 BRDN0001147757 AAGGCTCAACCTACAAACGG pXPR_003 CGG 762 46% 7 0.3356 PIP5K1A PIP5K1A 77963
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330689.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199304 CCCTCGTCTTTGACTAGGAAC pLKO.1 2456 3UTR 100% 4.050 2.835 N PIP5K1A n/a
2 TRCN0000195099 CGACGATGAGTTCATTATTAA pLKO.1 970 CDS 100% 15.000 9.000 N PIP5K1A n/a
3 TRCN0000231481 ACAGACTAGCTGGCACATTAT pLKO_005 2498 3UTR 100% 13.200 7.920 N PIP5K1A n/a
4 TRCN0000231477 ATTAAGACAGTCCAACATAAA pLKO_005 986 CDS 100% 13.200 7.920 N PIP5K1A n/a
5 TRCN0000024518 GCTTCCAGGATACTACATGAA pLKO.1 1030 CDS 100% 4.950 2.970 N Pip5k1a n/a
6 TRCN0000010129 AGCCCTGGTACATGACGGAGA pLKO.1 1669 CDS 100% 0.720 0.432 N PIP5K1A n/a
7 TRCN0000010128 GTTGATACTCGAAGACCGGCC pLKO.1 1451 CDS 100% 0.100 0.060 N PIP5K1A n/a
8 TRCN0000231478 TCGGACTTTGCTGCCTAAATT pLKO_005 1066 CDS 100% 15.000 7.500 Y PIP5K1A n/a
9 TRCN0000231480 AGTCAGAGTTCACCCATTAAG pLKO_005 2079 CDS 100% 13.200 6.600 Y PIP5K1A n/a
10 TRCN0000231479 CTCTTGATGTCAATCCATAAT pLKO_005 1382 CDS 100% 13.200 6.600 Y PIP5K1A n/a
11 TRCN0000195028 CCTCTTGATGTCAATCCATAA pLKO.1 1381 CDS 100% 10.800 5.400 Y PIP5K1A n/a
12 TRCN0000196711 GATGTCCTCATGCAAGATTTC pLKO.1 728 CDS 100% 10.800 5.400 Y PIP5K1A n/a
13 TRCN0000010142 ATAGGCCATAGAAGTGTTGAT pLKO.1 599 CDS 100% 4.950 2.475 Y PIP5K1A n/a
14 TRCN0000010138 TTTACCTCAGACTCCACCTTT pLKO.1 1945 CDS 100% 4.950 2.475 Y PIP5K1A n/a
15 TRCN0000010143 ATCCAGTTAGGCATTACCCAC pLKO.1 674 CDS 100% 2.160 1.080 Y PIP5K1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330689.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07233 pDONR223 100% 90.8% 90.9% None 83_85delCAG;933C>T;1328_1474del n/a
2 ccsbBroad304_07233 pLX_304 0% 90.8% 90.9% V5 83_85delCAG;933C>T;1328_1474del n/a
3 TRCN0000466603 ATCACCACTCATATCAAGTCGACA pLX_317 24.4% 90.8% 90.9% V5 83_85delCAG;933C>T;1328_1474del n/a
4 ccsbBroadEn_14891 pDONR223 0% 90.8% 90.9% None 83_85delCAG;933C>T;1328_1474del n/a
5 ccsbBroad304_14891 pLX_304 0% 90.8% 90.9% V5 83_85delCAG;933C>T;1328_1474del n/a
6 TRCN0000488868 CCATATAGGAAATTTCAAACAAAT pLX_317 22.3% 90.8% 90.9% V5 (not translated due to prior stop codon) 83_85delCAG;933C>T;1328_1474del n/a
7 ccsbBroadEn_10577 pDONR223 100% 85.9% 82% None (many diffs) n/a
8 ccsbBroad304_10577 pLX_304 0% 85.9% 82% V5 (many diffs) n/a
9 TRCN0000471767 CGCATACCATGCTAGACAACAGTG pLX_317 30.7% 85.9% 82% V5 (many diffs) n/a
10 ccsbBroadEn_10588 pDONR223 100% 54.1% 52.1% None (many diffs) n/a
11 ccsbBroad304_10588 pLX_304 0% 54.1% 52.1% V5 (many diffs) n/a
12 TRCN0000479417 GACGAAACCCTTTCATATAAAGAT pLX_317 11.8% 54.1% 52.1% V5 (many diffs) n/a
Download CSV