Construct: ORF TRCN0000471798
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016130.1_s317c1
- Derived from:
- ccsbBroadEn_09727
- DNA Barcode:
- CCAAAAGGATCGACAGTAAGCTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CXorf38 (159013)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471798
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 159013 | CXorf38 | chromosome X open reading f... | NM_144970.3 | 99.8% | 100% | 76T>C |
2 | human | 159013 | CXorf38 | chromosome X open reading f... | XM_005272589.3 | 99.8% | 100% | 76T>C |
3 | human | 159013 | CXorf38 | chromosome X open reading f... | XM_006724528.2 | 85.7% | 85.8% | 76T>C;214_215ins135 |
4 | human | 159013 | CXorf38 | chromosome X open reading f... | XM_017029303.1 | 85.7% | 85.8% | 76T>C;214_215ins135 |
5 | human | 159013 | CXorf38 | chromosome X open reading f... | XM_006724527.4 | 81% | 81.1% | 76T>C;619_620ins180 |
6 | human | 159013 | CXorf38 | chromosome X open reading f... | XM_017029302.1 | 75.3% | 75.4% | 1_153del;229T>C;502_503ins120 |
7 | human | 159013 | CXorf38 | chromosome X open reading f... | NM_001330455.2 | 62.6% | 62.6% | 0_1ins357 |
8 | human | 159013 | CXorf38 | chromosome X open reading f... | XM_017029304.1 | 62.6% | 62.6% | 0_1ins357 |
9 | mouse | 69155 | 1810030O07Rik | RIKEN cDNA 1810030O07 gene | NM_175141.6 | 85.7% | 86.2% | (many diffs) |
10 | mouse | 69155 | 1810030O07Rik | RIKEN cDNA 1810030O07 gene | XM_006527698.3 | 85.7% | 86.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1023
- ORF length:
- 957
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gctgtcggag ctagcggcgc gcctcaactg cgccgagtac aagaactggg 121 tgaaggcggg ccactgcctg ctactgctgc gcagctgcct gcagggtttc gtcggccgcg 181 aggtgctctc cttccaccgc ggcctactcg ccgcagcccc cggcctgggg ccccgcgccg 241 tctgccgcgg cggctcacgg tgcagccctc gcgcccgcca gtttcagcct cagtgtcagg 301 tgtgcgctga atggaaaagg gagattttga gacatcatgt caacagaaat ggagatgtgc 361 actggggaaa ctgccggccg ggccgctggc ccgtggacgc ctgggaggtg gccaaggcct 421 tcatgccccg aggactagca gacaaacaag gacctgagga atgtgatgca gttgctcttt 481 taagtctcat caactcctgc gatcacttcg tggttgatcg aaagaaagtc acagaggtaa 541 ttaaatgtcg taatgagatc atgcactctt cagagatgaa agtatcttct acgtggcttc 601 gagattttca gatgaagatc caaaattttc TGAATGAATT CAAGAACATC CCAGAGATTG 661 TGGCAGTATA CTCCAGAATA GAACAGCTGT TGACGTCTGA CTGGGCTGTT CACATCCCCG 721 AGGAAGATCA GCGAGATGGG TGTGAATGTG AAATGGGAAC TTACCTGAGT GAGAGCCAAG 781 TCAATGAAAT AGAAATGCAG TTACTAAAGG AGAAACTTCA AGAGATATAT CTTCAAGCAG 841 AAGAACAAGA GGTGTTGCCT GAAGAGCTCT CAAATCGACT GGAAGTGGTG AAGGAATTTC 901 TGAGAAACAA TGAGGATCTT AGAAATGGCC TTACAGAAGA TATGCAGAAG CTAGACAGCC 961 TCTGTCTACA TCAAAAACTG GATTCACAGG AACCTGGGAG ACAAACACCT GACAGGAAGG 1021 CCTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1081 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1141 GGCTTTATAT ATCTTGTGGA AAGGACGACC AAAAGGATCG ACAGTAAGCT CCACGCGTTA 1201 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt