Transcript: Mouse NM_175141.6

Mus musculus RIKEN cDNA 1810030O07 gene (1810030O07Rik), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
1810030O07Rik (69155)
Length:
2680
CDS:
99..1061

Additional Resources:

NCBI RefSeq record:
NM_175141.6
NBCI Gene record:
1810030O07Rik (69155)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175141.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200093 CGAGATCTTGAGGCATCACAT pLKO.1 353 CDS 100% 4.950 6.930 N 1810030O07Rik n/a
2 TRCN0000176909 GTAGCAGTATATTCCAGAATA pLKO.1 693 CDS 100% 13.200 10.560 N 1810030O07Rik n/a
3 TRCN0000350891 ATCTACCTGGCTTCGAGATTT pLKO_005 620 CDS 100% 13.200 9.240 N 1810030O07Rik n/a
4 TRCN0000375460 GAACGAGATGGGTGTGAATTT pLKO_005 762 CDS 100% 13.200 9.240 N 1810030O07Rik n/a
5 TRCN0000337951 GTGAGCCAAATCCACGAAATT pLKO_005 804 CDS 100% 13.200 9.240 N 1810030O07Rik n/a
6 TRCN0000375461 TTGCCAGAAGAGATCTCAAAT pLKO_005 888 CDS 100% 13.200 9.240 N 1810030O07Rik n/a
7 TRCN0000177216 GAGGTGATAAAGTGTCGAAAT pLKO.1 567 CDS 100% 10.800 7.560 N 1810030O07Rik n/a
8 TRCN0000177302 GCAGTATATTCCAGAATAGAA pLKO.1 696 CDS 100% 5.625 3.938 N 1810030O07Rik n/a
9 TRCN0000143356 GAATGTGATGCAGTTGCTCTT pLKO.1 492 CDS 100% 4.050 2.835 N CXorf38 n/a
10 TRCN0000176610 CGAAATGAGATAATGCACTCT pLKO.1 582 CDS 100% 2.640 1.848 N 1810030O07Rik n/a
11 TRCN0000338011 CGAAATGAGATAATGCACTCT pLKO_005 582 CDS 100% 2.640 1.848 N 1810030O07Rik n/a
12 TRCN0000177160 GCTTATTTAATCTTCCAGGTT pLKO.1 1290 3UTR 100% 2.640 1.848 N 1810030O07Rik n/a
13 TRCN0000337998 TCACCTCTGGACGTTACTATG pLKO_005 1089 3UTR 100% 10.800 6.480 N 1810030O07Rik n/a
14 TRCN0000182312 GCCTCCATCTACAGCATCAAA pLKO.1 991 CDS 100% 5.625 3.375 N 1810030O07Rik n/a
15 TRCN0000139242 CCTGAGGAATGTGATGCAGTT pLKO.1 486 CDS 100% 4.050 2.430 N CXorf38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175141.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09727 pDONR223 100% 85.7% 86.2% None (many diffs) n/a
2 ccsbBroad304_09727 pLX_304 0% 85.7% 86.2% V5 (many diffs) n/a
3 TRCN0000471798 CCAAAAGGATCGACAGTAAGCTCC pLX_317 41.2% 85.7% 86.2% V5 (many diffs) n/a
Download CSV