Transcript: Human XM_017029302.1

PREDICTED: Homo sapiens chromosome X open reading frame 38 (CXorf38), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CXorf38 (159013)
Length:
4241
CDS:
6..998

Additional Resources:

NCBI RefSeq record:
XM_017029302.1
NBCI Gene record:
CXorf38 (159013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145610 CAGAGTATTGTACCCAAACAA pLKO.1 1091 3UTR 100% 5.625 7.875 N CXorf38 n/a
2 TRCN0000140216 GCTCTCAAATCGACTGGAAGT pLKO.1 839 CDS 100% 4.050 5.670 N CXorf38 n/a
3 TRCN0000144199 CCTCTAACTCTTTGGAACTAT pLKO.1 1144 3UTR 100% 5.625 3.938 N CXorf38 n/a
4 TRCN0000145117 GCAGTATACTCCAGAATAGAA pLKO.1 636 CDS 100% 5.625 3.938 N CXorf38 n/a
5 TRCN0000144242 CTGAGAAACAATGAGGATCTT pLKO.1 873 CDS 100% 4.950 3.465 N CXorf38 n/a
6 TRCN0000143023 CTTCCATCTCAGACATCCTTT pLKO.1 1047 3UTR 100% 4.950 3.465 N CXorf38 n/a
7 TRCN0000144739 GTAATGAGATCATGCACTCTT pLKO.1 523 CDS 100% 4.950 3.465 N CXorf38 n/a
8 TRCN0000144915 GTGAATGTGAAATGGGAACTT pLKO.1 715 CDS 100% 4.950 3.465 N CXorf38 n/a
9 TRCN0000140509 GCTTCCATCTCAGACATCCTT pLKO.1 1046 3UTR 100% 3.000 2.100 N CXorf38 n/a
10 TRCN0000143560 GAGGATCTTAGAAATGGCCTT pLKO.1 885 CDS 100% 2.160 1.512 N CXorf38 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3691 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3692 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1436 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09727 pDONR223 100% 75.3% 75.4% None 1_153del;229T>C;502_503ins120 n/a
2 ccsbBroad304_09727 pLX_304 0% 75.3% 75.4% V5 1_153del;229T>C;502_503ins120 n/a
3 TRCN0000471798 CCAAAAGGATCGACAGTAAGCTCC pLX_317 41.2% 75.3% 75.4% V5 1_153del;229T>C;502_503ins120 n/a
Download CSV