Construct: ORF TRCN0000471814
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000958.1_s317c1
- Derived from:
- ccsbBroadEn_03035
- DNA Barcode:
- TCCCACGTCTCTTGTAGTGGGTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RABGEF1 (27342)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471814
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001287062.2 | 100% | 100% | |
| 2 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367725.1 | 100% | 100% | |
| 3 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367726.1 | 100% | 100% | |
| 4 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367727.1 | 100% | 100% | |
| 5 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367728.1 | 100% | 100% | |
| 6 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367729.1 | 100% | 100% | |
| 7 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367730.1 | 100% | 100% | |
| 8 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367731.1 | 100% | 100% | |
| 9 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367732.1 | 100% | 100% | |
| 10 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367733.1 | 100% | 100% | |
| 11 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367734.1 | 100% | 100% | |
| 12 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367735.1 | 100% | 100% | |
| 13 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367736.1 | 100% | 100% | |
| 14 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_014504.3 | 100% | 100% | |
| 15 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367737.1 | 99.7% | 99.7% | 346_348delGCA |
| 16 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367738.1 | 99.7% | 99.7% | 346_348delGCA |
| 17 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367739.1 | 99.7% | 99.7% | 346_348delGCA |
| 18 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367740.1 | 99.7% | 99.7% | 346_348delGCA |
| 19 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001287061.2 | 97.2% | 97.2% | 1_42del |
| 20 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367741.1 | 92.6% | 92.6% | 595_711del |
| 21 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367742.1 | 92.6% | 92.6% | 595_711del |
| 22 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367743.1 | 87.4% | 84% | 0_1ins65;115_251del |
| 23 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367744.1 | 87.4% | 84% | 0_1ins65;115_251del |
| 24 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367756.1 | 84.3% | 84.3% | 136_137ins231 |
| 25 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367753.1 | 83% | 83% | 345_346ins249 |
| 26 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367754.1 | 74.2% | 73% | 1078_1081delGTGA;1101_1102ins376 |
| 27 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367755.1 | 74.2% | 73.5% | (many diffs) |
| 28 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367752.1 | 74.1% | 72.9% | 346_348delGCA;1081_1084delGTGA;1104_1105ins376 |
| 29 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367745.1 | 66.1% | 66.1% | 0_1ins498 |
| 30 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367746.1 | 66.1% | 66.1% | 0_1ins498 |
| 31 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367747.1 | 66.1% | 66.1% | 0_1ins498 |
| 32 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367748.1 | 66.1% | 66.1% | 0_1ins498 |
| 33 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001287060.2 | 60.8% | 60.8% | 0_1ins576 |
| 34 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367722.1 | 60.8% | 60.8% | 0_1ins576 |
| 35 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367723.1 | 60.8% | 60.8% | 0_1ins576 |
| 36 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367724.1 | 60.8% | 60.8% | 0_1ins576 |
| 37 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367749.1 | 57.8% | 57.8% | 0_1ins621 |
| 38 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367750.1 | 57.8% | 57.8% | 0_1ins621 |
| 39 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NM_001367751.1 | 57.8% | 57.8% | 0_1ins621 |
| 40 | human | 27342 | RABGEF1 | RAB guanine nucleotide exch... | NR_160287.1 | 38.9% | 1_77del;896_943del;1599_3781del | |
| 41 | mouse | 56715 | Rabgef1 | RAB guanine nucleotide exch... | NM_001199059.1 | 88.6% | 95.7% | (many diffs) |
| 42 | mouse | 56715 | Rabgef1 | RAB guanine nucleotide exch... | NM_019983.2 | 88.6% | 95.7% | (many diffs) |
| 43 | mouse | 56715 | Rabgef1 | RAB guanine nucleotide exch... | XM_006504448.2 | 88.4% | 95.5% | (many diffs) |
| 44 | mouse | 56715 | Rabgef1 | RAB guanine nucleotide exch... | XM_006504447.3 | 85.4% | 92.3% | (many diffs) |
| 45 | mouse | 56715 | Rabgef1 | RAB guanine nucleotide exch... | XM_006504446.3 | 85.3% | 92.1% | (many diffs) |
| 46 | mouse | 56715 | Rabgef1 | RAB guanine nucleotide exch... | XM_017321033.1 | 53.7% | 58.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1539
- ORF length:
- 1473
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag ccttaagtct gaacgccgag gaattcatgt ggatcaatcg gatctcctgt 121 gcaagaaagg atgtggttac tacggcaacc ctgcctggca gggtttctgc tccaagtgct 181 ggagggaaga gtaccacaaa gccaggcaga agcagattca ggaggactgg gagctggcgg 241 agcgactcca gcgggaggaa gaagaggcct ttgccagcag tcagagcagc caaggggccc 301 aatccctcac attctccaag tttgaagaaa agaaaaccaa cgagaagacc cgcaaggtta 361 ccacagtgaa gaaattcttc agtgcatctt ccagggtcgg atcaaagaag gaaattcagg 421 aagcaaaagc tcccagtcct tccataaacc ggcaaaccag cattgaaacg gatagagtgt 481 ctaaggagtt catagaattt ctcaagacct tccacaagac aggccaagaa atctataaac 541 agaccaagct gtttttggaa ggaatgcatt acaaaaggga tctaagcatt gaagaacagt 601 cagagtgtgc tcaggatttc taccacaatg tggccgaaag gatgcaaact cgtgggaaag 661 tgcctccaga aagagtcgag aagataatgg atcagattga aaagtacatc atgactcgtc 721 tctataaata tgtattctgt ccagaaacta ctgatgatga gaagaaagat cttgccattc 781 aaaagagaat cagagccctg cgctgggtta cgcctcagat gctgtgtgtc cctgttaatg 841 aagacatccc agaagtgtct gatatggtgg tgaaggcgat cacagatatc attgaaatgg 901 attccaagcg tgtgcctcga gacaagctgg cctgcatcac caagtgcagc aagcacatct 961 tcaatgccat caagatcacc aagaatgagc cggcgtcagc ggatgacttc ctccccaccc 1021 tcatctacat tgttttgaag ggcaaccccc cacgccttca gtctaatatc cagtatatca 1081 cgcgcttctg caatccaagc cgactgatga ctggagagga tggctactat ttcaccaatc 1141 tgtgctgtgc tgtggctttc attgagaagc tagacgccca gtctttgaat ctaagtcagg 1201 aggattttga tcgctacatg tctggccaga cctctcccag gaagcaagaa gctgagagtt 1261 ggtctcctga tgcttgctta ggcgtcaagc aaatgtataa gaacttggat ctcttgtcTC 1321 AGTTGAATGA ACGACAAGAA AGGATCATGA ATGAAGCCAA GAAACTGGAA AAAGACCTCA 1381 TAGATTGGAC AGATGGAATT GCAAGAGAAG TTCAAGACAT CGTTGAGAAA TACCCACTGG 1441 AAATTAAGCC TCCGAATCAA CCGTTAGCAG CTATTGACTC TGAAAACGTT GAAAATGATA 1501 AACTTCCTCC ACCACTGCAA CCTCAAGTTT ATGCAGGATG CCCCACTTTC TTGTACAAAG 1561 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1621 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1681 ACGATCCCAC GTCTCTTGTA GTGGGTTAAC GCGTTAAGTC gacaatcaac ctctggatta 1741 caaaatttgt gaaagatt