Transcript: Human NM_001367733.1

Homo sapiens RAB guanine nucleotide exchange factor 1 (RABGEF1), transcript variant 17, mRNA.

Source:
NCBI, updated 2019-02-28
Taxon:
Homo sapiens (human)
Gene:
RABGEF1 (27342)
Length:
3847
CDS:
192..1667

Additional Resources:

NCBI RefSeq record:
NM_001367733.1
NBCI Gene record:
RABGEF1 (27342)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047234 CGATCACAGATATCATTGAAA pLKO.1 1003 CDS 100% 5.625 7.875 N RABGEF1 n/a
2 TRCN0000047233 CGTCAAGCAAATGTATAAGAA pLKO.1 1409 CDS 100% 5.625 4.500 N RABGEF1 n/a
3 TRCN0000419718 ATGCAGGATGATCACAATTTA pLKO_005 1657 CDS 100% 15.000 10.500 N RABGEF1 n/a
4 TRCN0000047237 CCAGAAAGAGTCGAGAAGATA pLKO.1 792 CDS 100% 5.625 3.938 N RABGEF1 n/a
5 TRCN0000047235 GTCCTTCCATAAACCGGCAAA pLKO.1 562 CDS 100% 4.050 2.835 N RABGEF1 n/a
6 TRCN0000422664 CCACGCCTTCAGTCTAATATC pLKO_005 1176 CDS 100% 13.200 7.920 N RABGEF1 n/a
7 TRCN0000047236 GTTCAAGACATCGTTGAGAAA pLKO.1 1536 CDS 100% 4.950 2.970 N RABGEF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367733.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03035 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03035 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471814 TCCCACGTCTCTTGTAGTGGGTTA pLX_317 15.4% 100% 100% V5 n/a
Download CSV