Transcript: Mouse NM_001199059.1

Mus musculus RAB guanine nucleotide exchange factor (GEF) 1 (Rabgef1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Rabgef1 (56715)
Length:
2698
CDS:
84..1559

Additional Resources:

NCBI RefSeq record:
NM_001199059.1
NBCI Gene record:
Rabgef1 (56715)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001199059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093370 CCGAGTGACTAAGGAGTTCAT pLKO.1 491 CDS 100% 4.950 6.930 N Rabgef1 n/a
2 TRCN0000331978 CCGAGTGACTAAGGAGTTCAT pLKO_005 491 CDS 100% 4.950 6.930 N Rabgef1 n/a
3 TRCN0000093369 CGGAATATGAACTGACTGCTT pLKO.1 1617 3UTR 100% 2.640 3.696 N Rabgef1 n/a
4 TRCN0000309664 CGGAATATGAACTGACTGCTT pLKO_005 1617 3UTR 100% 2.640 3.696 N Rabgef1 n/a
5 TRCN0000093373 GCGTCTCTATAAATTTGTGTT pLKO.1 734 CDS 100% 4.950 3.960 N Rabgef1 n/a
6 TRCN0000309602 GCGTCTCTATAAATTTGTGTT pLKO_005 734 CDS 100% 4.950 3.960 N Rabgef1 n/a
7 TRCN0000093371 CCTGATCTACATCGTCCTGAA pLKO.1 1037 CDS 100% 4.050 2.835 N Rabgef1 n/a
8 TRCN0000309663 CCTGATCTACATCGTCCTGAA pLKO_005 1037 CDS 100% 4.050 2.835 N Rabgef1 n/a
9 TRCN0000093372 CCTGCTTAGGTGTGAAGCAAA pLKO.1 1291 CDS 100% 0.495 0.347 N Rabgef1 n/a
10 TRCN0000309662 CCTGCTTAGGTGTGAAGCAAA pLKO_005 1291 CDS 100% 0.495 0.347 N Rabgef1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199059.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03035 pDONR223 100% 88.6% 95.7% None (many diffs) n/a
2 ccsbBroad304_03035 pLX_304 0% 88.6% 95.7% V5 (many diffs) n/a
3 TRCN0000471814 TCCCACGTCTCTTGTAGTGGGTTA pLX_317 15.4% 88.6% 95.7% V5 (many diffs) n/a
Download CSV