Construct: ORF TRCN0000471845
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010872.1_s317c1
- Derived from:
- ccsbBroadEn_08836
- DNA Barcode:
- ATCCTTATGAAAAAATCTTTTGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMBIM1 (64114)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471845
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 64114 | TMBIM1 | transmembrane BAX inhibitor... | NM_001321427.1 | 99.8% | 99.6% | 62C>T |
| 2 | human | 64114 | TMBIM1 | transmembrane BAX inhibitor... | NM_001321428.1 | 99.8% | 99.6% | 62C>T |
| 3 | human | 64114 | TMBIM1 | transmembrane BAX inhibitor... | NM_001321429.1 | 99.8% | 99.6% | 62C>T |
| 4 | human | 64114 | TMBIM1 | transmembrane BAX inhibitor... | NM_001321430.1 | 99.8% | 99.6% | 62C>T |
| 5 | human | 64114 | TMBIM1 | transmembrane BAX inhibitor... | NM_001321432.1 | 99.8% | 99.6% | 62C>T |
| 6 | human | 64114 | TMBIM1 | transmembrane BAX inhibitor... | NM_001321433.1 | 99.8% | 99.6% | 62C>T |
| 7 | human | 64114 | TMBIM1 | transmembrane BAX inhibitor... | NM_001321435.1 | 99.8% | 99.6% | 62C>T |
| 8 | human | 64114 | TMBIM1 | transmembrane BAX inhibitor... | NM_001321436.1 | 99.8% | 99.6% | 62C>T |
| 9 | human | 64114 | TMBIM1 | transmembrane BAX inhibitor... | NM_022152.6 | 99.7% | 99.6% | 62C>T;237A>G |
| 10 | human | 64114 | TMBIM1 | transmembrane BAX inhibitor... | XM_011511627.1 | 99.7% | 99.6% | 62C>T;237A>G |
| 11 | human | 64114 | TMBIM1 | transmembrane BAX inhibitor... | NM_001321438.1 | 64.3% | 60.7% | 0_1ins268;35_36ins65 |
| 12 | human | 64114 | TMBIM1 | transmembrane BAX inhibitor... | NR_135643.1 | 35.9% | (many diffs) | |
| 13 | mouse | 69660 | Tmbim1 | transmembrane BAX inhibitor... | NM_027154.5 | 84.6% | 88.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 999
- ORF length:
- 933
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc caaccccagc gccccaccac catatgaaga ccgcaacccc ctgtacccag 121 gccctctgcc ccctgggggc tatgggcagc catctgtcct gccaggaggg tatcctgcct 181 accctggcta cccgcagcct ggctacggtc accctgctgg ctacccacag cccatgcccc 241 ccacccaccc gatgcccatg aactacggcc caggccatgg ctatgatggg gaggagagag 301 cggtgagtga tagcttcggg cctggagagt gggatgaccg gaaagtgcga cacactttta 361 tccgaaaggt ttactccatc atctccgtgc agctgctcat cactgtggcc atcattgcta 421 tcttcacctt tgtggaacct gtcagcgcct ttgtgaggag aaatgtggct gtctactacg 481 tgtcctatgc tgtcttcgtt gtcacctacc tgatccttgc ctgctgccag ggacccagac 541 gccgtttccc atggaacatc attctgctga ccctttttac ttttgccatg ggcttcatga 601 cgggcaccat TTCCAGTATG TACCAAACCA AAGCCGTCAT CATTGCAATG ATCATCACTG 661 CGGTGGTATC CATTTCAGTC ACCATCTTCT GCTTTCAGAC CAAGGTGGAC TTCACCTCGT 721 GCACAGGCCT CTTCTGTGTC CTGGGAATTG TGCTCCTGGT GACTGGGATT GTCACTAGCA 781 TTGTGCTCTA CTTCCAATAC GTTTACTGGC TCCACATGCT CTATGCTGCT CTGGGGGCCA 841 TTTGTTTCAC CCTGTTCCTG GCTTACGACA CACAGCTGGT CCTGGGGAAC CGGAAGCACA 901 CCATCAGCCC CGAGGACTAC ATCACTGGCG CCCTGCAGAT TTACACAGAC ATCATCTACA 961 TCTTCACCTT TGTGCTGCAG CTGATGGGGG ATCGCAATTG CCCAACTTTC TTGTACAAAG 1021 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1081 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1141 ACGAATCCTT ATGAAAAAAT CTTTTGTTAC GCGTTAAGTC gacaatcaac ctctggatta 1201 caaaatttgt gaaagatt