Transcript: Human NM_001321428.1

Homo sapiens transmembrane BAX inhibitor motif containing 1 (TMBIM1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
TMBIM1 (64114)
Length:
2374
CDS:
138..1073

Additional Resources:

NCBI RefSeq record:
NM_001321428.1
NBCI Gene record:
TMBIM1 (64114)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163128 GACTGGGATTGTCACTAGCAT pLKO.1 833 CDS 100% 3.000 4.200 N TMBIM1 n/a
2 TRCN0000161399 GTGCTCTACTTCCAATACGTT pLKO.1 855 CDS 100% 3.000 4.200 N TMBIM1 n/a
3 TRCN0000292191 GTGCTCTACTTCCAATACGTT pLKO_005 855 CDS 100% 3.000 4.200 N TMBIM1 n/a
4 TRCN0000163608 CCAAACCAAAGCCGTCATCAT pLKO.1 695 CDS 100% 4.950 3.960 N TMBIM1 n/a
5 TRCN0000161145 CCGAAAGGTTTACTCCATCAT pLKO.1 434 CDS 100% 4.950 3.960 N TMBIM1 n/a
6 TRCN0000297960 CCGAAAGGTTTACTCCATCAT pLKO_005 434 CDS 100% 4.950 3.960 N TMBIM1 n/a
7 TRCN0000163955 CCGTTTCCCATGGAACATCAT pLKO.1 614 CDS 100% 4.950 3.465 N TMBIM1 n/a
8 TRCN0000292247 CCGTTTCCCATGGAACATCAT pLKO_005 614 CDS 100% 4.950 3.465 N TMBIM1 n/a
9 TRCN0000163344 GCTGTCTACTACGTGTCCTAT pLKO.1 540 CDS 100% 4.950 3.465 N TMBIM1 n/a
10 TRCN0000292190 GCTGTCTACTACGTGTCCTAT pLKO_005 540 CDS 100% 4.950 3.465 N TMBIM1 n/a
11 TRCN0000160537 CATCATTGCTATCTTCACCTT pLKO.1 482 CDS 100% 2.640 1.848 N TMBIM1 n/a
12 TRCN0000292192 CATCATTGCTATCTTCACCTT pLKO_005 482 CDS 100% 2.640 1.848 N TMBIM1 n/a
13 TRCN0000162190 CATTTGTTTCACCCTGTTCCT pLKO.1 911 CDS 100% 2.640 1.848 N TMBIM1 n/a
14 TRCN0000159824 GATTTACACAGACATCATCTA pLKO.1 1010 CDS 100% 4.950 2.970 N TMBIM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321428.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15963 pDONR223 0% 99.8% 100% None 846C>G n/a
2 ccsbBroad304_15963 pLX_304 0% 99.8% 100% V5 846C>G n/a
3 TRCN0000469775 GACGGATCCTAGGAAGAACCTATT pLX_317 51.2% 99.7% 57.3% V5 (not translated due to prior stop codon) 508_509insT;846C>G n/a
4 ccsbBroadEn_08836 pDONR223 100% 99.8% 99.6% None 62C>T n/a
5 ccsbBroad304_08836 pLX_304 0% 99.8% 99.6% V5 62C>T n/a
6 TRCN0000471845 ATCCTTATGAAAAAATCTTTTGTT pLX_317 41.8% 99.8% 99.6% V5 62C>T n/a
Download CSV