Transcript: Mouse NM_027154.5

Mus musculus transmembrane BAX inhibitor motif containing 1 (Tmbim1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tmbim1 (69660)
Length:
2325
CDS:
255..1184

Additional Resources:

NCBI RefSeq record:
NM_027154.5
NBCI Gene record:
Tmbim1 (69660)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027154.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248115 CCTTTACCCATGACGAGTATG pLKO_005 1407 3UTR 100% 10.800 15.120 N Tmbim1 n/a
2 TRCN0000248119 TGACCGGAAAGTTCGACATTC pLKO_005 518 CDS 100% 10.800 15.120 N Tmbim1 n/a
3 TRCN0000248117 ACTACGGCCATGACTATAATG pLKO_005 451 CDS 100% 13.200 9.240 N Tmbim1 n/a
4 TRCN0000248118 GCTTTGTGACAGGCACTATTT pLKO_005 775 CDS 100% 13.200 9.240 N Tmbim1 n/a
5 TRCN0000248116 TGTGGAACCAGTCGGCAAATA pLKO_005 614 CDS 100% 13.200 9.240 N Tmbim1 n/a
6 TRCN0000174987 GCTGCTTTCTATGTAATCCAA pLKO.1 2116 3UTR 100% 3.000 2.100 N Tmbim1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027154.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15963 pDONR223 0% 84.8% 88.7% None (many diffs) n/a
2 ccsbBroad304_15963 pLX_304 0% 84.8% 88.7% V5 (many diffs) n/a
3 TRCN0000469775 GACGGATCCTAGGAAGAACCTATT pLX_317 51.2% 84.8% 53.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_08836 pDONR223 100% 84.6% 88.4% None (many diffs) n/a
5 ccsbBroad304_08836 pLX_304 0% 84.6% 88.4% V5 (many diffs) n/a
6 TRCN0000471845 ATCCTTATGAAAAAATCTTTTGTT pLX_317 41.8% 84.6% 88.4% V5 (many diffs) n/a
Download CSV