Construct: ORF TRCN0000472060
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007258.1_s317c1
- Derived from:
- ccsbBroadEn_11686
- DNA Barcode:
- CCATCTATGTTCCGCCATTTCTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZC3H3 (23144)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472060
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 23144 | ZC3H3 | zinc finger CCCH-type conta... | NM_015117.3 | 34.3% | 33.4% | (many diffs) |
2 | human | 23144 | ZC3H3 | zinc finger CCCH-type conta... | XM_006716536.3 | 32.2% | 31.3% | (many diffs) |
3 | human | 23144 | ZC3H3 | zinc finger CCCH-type conta... | XM_017013248.1 | 30.2% | 29.4% | (many diffs) |
4 | human | 23144 | ZC3H3 | zinc finger CCCH-type conta... | XM_017013249.1 | 30.2% | 29.4% | (many diffs) |
5 | human | 23144 | ZC3H3 | zinc finger CCCH-type conta... | XM_011516943.2 | 15.7% | 14.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1071
- ORF length:
- 1005
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaatag 61 ttggcatgga gccaggagga gagcccacag gtgctaaaga gagcagtacc ctgatggagt 121 cccttgcagg ccggctggat cctgcaggca gctgtagccg ttccctggcc agccgggcag 181 tgcagcgcag cctggccatc atccggcagg cgcggcagcg cagggagaag aggaaggagt 241 actgcatgta ctacaaccgc ttcggcaggt gcaaccgtgg cgagcgctgc ccctacatcc 301 acgatcccga gaaggtggcc gtgtgcacca ggtttgtccg gggcacctgc aagaaaacgg 361 atgggacctg ccccttctcc caccatgtgt ccaaggagaa gatgccggtg tgctcctact 421 tcctgaaggg catctgcagc aacagcaact gtccctatag ccacgtgtac gtgtcccgca 481 aggccgaggt ctgcagcgac ttcctcaaag gctactgccc cctgggtgca aagtgcaaga 541 agaaacacac gctgctgtgc cccgactttg cccgcagggg ggcgtgtccc cgcggcgccc 601 agtgccagct gctccaccgt acccagaaac gccacagtcg gcgggcagcc acgTCCCCCG 661 CCCCAGGGCC CAGCGACGCA ACCGCCAGGA GCAGGGTCTC GGCCAGCCAC GGGCCCAGGA 721 AGCCTTCAGC ATCCCAGCGC CCCACCAGGC AGACGCCCAG CTCGGCTGCC CTCACTGCGG 781 CTGCCGTGGC TGCACCTCCC CACTGCCCAG GGGGGTCAGC CTCTCCCTCA TCCTCGAAGG 841 CTTCCTCCTC CTCCTCCTCC TCCTCATCCC CTCCCGCTTC CTTGGACCAC GAGGCACCAT 901 CTCTCCAGGA GGCTGCCTTA GCAGCAGCGT GCTCCAACAG GCTCTGCAAG CTGCCTTCCT 961 TCATCTCCCT GCAGTCCTCG CCGAGCCCAG GAGCCCAGCC CAGGGTCCGG GCCCCTAGGG 1021 CCCCCCTCAC CAAGGACTCA GGGAAGCCTC TGCACATCAA ACCACGTCTG TGCCCAACTT 1081 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1141 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1201 CTTGTGGAAA GGACGACCAT CTATGTTCCG CCATTTCTCG ACGCGTTAAG TCgacaatca 1261 acctctggat tacaaaattt gtgaaagatt