Transcript: Human XM_006716536.3

PREDICTED: Homo sapiens zinc finger CCCH-type containing 3 (ZC3H3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZC3H3 (23144)
Length:
3666
CDS:
233..3265

Additional Resources:

NCBI RefSeq record:
XM_006716536.3
NBCI Gene record:
ZC3H3 (23144)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716536.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365519 GAACGTGGTCATCAAAGTTAA pLKO_005 781 CDS 100% 13.200 18.480 N ZC3H3 n/a
2 TRCN0000365459 CAGTCAGTGAGAGTGTGATTG pLKO_005 1071 CDS 100% 10.800 15.120 N ZC3H3 n/a
3 TRCN0000138090 GCTACCGCATTGTCAAGAAGA pLKO.1 2034 CDS 100% 4.950 3.960 N ZC3H3 n/a
4 TRCN0000376720 AGAAATACTCCCTCGTGAATC pLKO_005 633 CDS 100% 10.800 7.560 N ZC3H3 n/a
5 TRCN0000138141 GCAACAGCAACTGTCCCTATA pLKO.1 2631 CDS 100% 10.800 7.560 N ZC3H3 n/a
6 TRCN0000370585 GGAAGCCTCTGCACATCAAAC pLKO_005 3234 CDS 100% 10.800 7.560 N ZC3H3 n/a
7 TRCN0000135992 GACCTGTCGAACTAACAAGTT pLKO.1 1315 CDS 100% 4.950 3.465 N ZC3H3 n/a
8 TRCN0000370583 AGAGGAAAGAGGCTCTGTCCA pLKO_005 3312 3UTR 100% 2.640 1.848 N ZC3H3 n/a
9 TRCN0000137976 GCAAGAAATACTCCCTCGTGA pLKO.1 630 CDS 100% 2.640 1.848 N ZC3H3 n/a
10 TRCN0000370582 CACCTACCTCAGACCCTCATC pLKO_005 3286 3UTR 100% 1.350 0.945 N ZC3H3 n/a
11 TRCN0000138111 GTGCAAGAAGAAACACACGCT pLKO.1 2725 CDS 100% 0.660 0.462 N ZC3H3 n/a
12 TRCN0000135666 GAAGGAGTACTGCATGTACTA pLKO.1 2425 CDS 100% 0.495 0.347 N ZC3H3 n/a
13 TRCN0000136418 CAGAACGTGGTCATCAAAGTT pLKO.1 779 CDS 100% 5.625 3.375 N ZC3H3 n/a
14 TRCN0000370584 GGTCTGATTGATGACTACAAA pLKO_005 464 CDS 100% 5.625 3.375 N ZC3H3 n/a
15 TRCN0000138517 CATGGCAAACAAGGTGGAGAA pLKO.1 1447 CDS 100% 4.050 2.430 N ZC3H3 n/a
16 TRCN0000198971 GCAAGTACAAGTGGAAGGCTT pLKO.1 1542 CDS 100% 2.640 2.112 N Zc3h3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716536.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11686 pDONR223 100% 32.2% 31.3% None (many diffs) n/a
2 ccsbBroad304_11686 pLX_304 0% 32.2% 31.3% V5 (many diffs) n/a
3 TRCN0000472060 CCATCTATGTTCCGCCATTTCTCG pLX_317 41.7% 32.2% 31.3% V5 (many diffs) n/a
Download CSV