Construct: ORF TRCN0000472083
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018361.1_s317c1
- Derived from:
- ccsbBroadEn_07030
- DNA Barcode:
- CTCTTAAAGTCGAATCAAACGTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TADA2A (6871)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472083
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6871 | TADA2A | transcriptional adaptor 2A | NM_001291918.2 | 99.8% | 99.6% | 349C>T |
| 2 | human | 6871 | TADA2A | transcriptional adaptor 2A | NM_133439.4 | 99.8% | 99.6% | 349C>T |
| 3 | human | 6871 | TADA2A | transcriptional adaptor 2A | NM_001166105.3 | 66% | 60.6% | (many diffs) |
| 4 | human | 6871 | TADA2A | transcriptional adaptor 2A | NM_001488.4 | 66% | 60.6% | (many diffs) |
| 5 | human | 6871 | TADA2A | transcriptional adaptor 2A | XM_017024981.1 | 61.5% | 56.3% | (many diffs) |
| 6 | human | 6871 | TADA2A | transcriptional adaptor 2A | XM_017024982.1 | 53.9% | 48.9% | (many diffs) |
| 7 | human | 6871 | TADA2A | transcriptional adaptor 2A | XM_011525153.2 | 51.9% | 46.9% | (many diffs) |
| 8 | human | 6871 | TADA2A | transcriptional adaptor 2A | XM_011525154.2 | 51.9% | 46.9% | (many diffs) |
| 9 | human | 6871 | TADA2A | transcriptional adaptor 2A | XM_006722044.3 | 43.3% | 38.6% | (many diffs) |
| 10 | human | 6871 | TADA2A | transcriptional adaptor 2A | XM_011525155.2 | 43.3% | 38.6% | (many diffs) |
| 11 | human | 6871 | TADA2A | transcriptional adaptor 2A | XM_017024983.1 | 43.3% | 38.6% | (many diffs) |
| 12 | human | 6871 | TADA2A | transcriptional adaptor 2A | XM_017024984.1 | 43.3% | 38.6% | (many diffs) |
| 13 | human | 6871 | TADA2A | transcriptional adaptor 2A | XM_017024985.1 | 43.3% | 38.6% | (many diffs) |
| 14 | human | 6871 | TADA2A | transcriptional adaptor 2A | XM_017024986.1 | 20.3% | 16.3% | (many diffs) |
| 15 | mouse | 217031 | Tada2a | transcriptional adaptor 2A | XM_011248932.2 | 81.5% | 87.2% | (many diffs) |
| 16 | mouse | 217031 | Tada2a | transcriptional adaptor 2A | NM_172562.3 | 60.1% | 59.1% | (many diffs) |
| 17 | mouse | 217031 | Tada2a | transcriptional adaptor 2A | XM_006532989.3 | 56.2% | 54.8% | (many diffs) |
| 18 | mouse | 217031 | Tada2a | transcriptional adaptor 2A | XR_001779958.1 | 35.3% | (many diffs) | |
| 19 | mouse | 217031 | Tada2a | transcriptional adaptor 2A | XM_006532991.1 | 26.9% | 24.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 981
- ORF length:
- 915
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ccgtttgggt tcctttagca atgatccctc tgataagcca ccttgccgag 121 gctgctcctc ctacctcatg gagccttata tcaagtgtgc tgaatgtggg ccacctcctt 181 ttttcctctg cttgcagtgt ttcactcgag gctttgagta caagaaacat caaagcgatc 241 atacttatga aataatgact tcagattttc ctgtccttga tcccagctgg actgctcaag 301 aagaaatggc ccttttagaa gctgtgatgg actgtggctt tggaaattgg caggatgtag 361 ccaatcaaat gtgcaccaag accaaggagg agtgtgagaa gcactatatg aagtatttca 421 tcaataaccc tctgtttgca tctaccctgc tgaacctgaa acaagcagag gaagcaaaaa 481 ctgctgacac agccattcca tttcactcta cagatgaccc tccccgacct acctttgact 541 ccttgctttc tcgggacatg gCCGGGTACA TGCCAGCTCG AGCAGATTTC ATTGAGGAAT 601 TTGACAATTA TGCAGAATGG GACTTGAGAG ACATTGATTT TGTTGAAGAT GACTCGGACA 661 TTTTACATGC TCTGAAGATG GCTGTGGTAG ATATCTATCA TTCCAGGTTA AAGGAGAGAC 721 AAAGACGAAA AAAAATTATA AGAGACCATG GATTAATCAA CCTTAGAAAG TTTCAATTAA 781 TGGAACGGCG GTATCCCAAG GAGGTCCAGG ACCTGTATGA AACAATGAGG CGATTTGCAA 841 GAATTGTGGG GCCAGTGGAA CATGACAAAT TCATTGAAAG CCATGCATGT AGGTGGTTTT 901 TGAGCCTTGA GCAGTATTTG TGTGTGTATA TTTATATAAA TAGGAGAGAT AATGGTGTGT 961 TTTATGTGAA GTTCTATAAA TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1021 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1081 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACTCT TAAAGTCGAA 1141 TCAAACGTTA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt