Transcript: Mouse XM_011248932.2

PREDICTED: Mus musculus transcriptional adaptor 2A (Tada2a), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tada2a (217031)
Length:
1494
CDS:
188..1012

Additional Resources:

NCBI RefSeq record:
XM_011248932.2
NBCI Gene record:
Tada2a (217031)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304977 CCTTAGGAAGTTCCGATTAAT pLKO_005 883 CDS 100% 15.000 21.000 N Tada2a n/a
2 TRCN0000304928 CTCACGGAACCTTACATTAAA pLKO_005 257 CDS 100% 15.000 21.000 N Tada2a n/a
3 TRCN0000304926 GTGATCACACTTACGAAATAA pLKO_005 357 CDS 100% 15.000 10.500 N Tada2a n/a
4 TRCN0000039245 CCAAGACCTTTATGAAACAAT pLKO.1 928 CDS 100% 5.625 3.938 N Tada2a n/a
5 TRCN0000302752 CCAAGACCTTTATGAAACAAT pLKO_005 928 CDS 100% 5.625 3.938 N Tada2a n/a
6 TRCN0000039248 GCTAATCAAATGTGCACCAAA pLKO.1 482 CDS 100% 4.950 3.465 N Tada2a n/a
7 TRCN0000039244 CGAGGATTTGAGTACAAGAAA pLKO.1 329 CDS 100% 5.625 3.375 N Tada2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07030 pDONR223 100% 81.5% 87.2% None (many diffs) n/a
2 ccsbBroad304_07030 pLX_304 0% 81.5% 87.2% V5 (many diffs) n/a
3 TRCN0000472083 CTCTTAAAGTCGAATCAAACGTTA pLX_317 45.9% 81.5% 87.2% V5 (many diffs) n/a
4 ccsbBroadEn_07029 pDONR223 100% 56.1% 60% None (many diffs) n/a
5 ccsbBroad304_07029 pLX_304 0% 56.1% 60% V5 (many diffs) n/a
6 TRCN0000474554 CCTCTATGCGGCAGATTTGGTTGA pLX_317 43.5% 56.1% 60% V5 (many diffs) n/a
Download CSV