Transcript: Human XM_017024982.1

PREDICTED: Homo sapiens transcriptional adaptor 2A (TADA2A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TADA2A (6871)
Length:
4074
CDS:
162..1331

Additional Resources:

NCBI RefSeq record:
XM_017024982.1
NBCI Gene record:
TADA2A (6871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024982.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274158 TATAAGAGACCATGGATTAAT pLKO_005 671 CDS 100% 15.000 21.000 N TADA2A n/a
2 TRCN0000274211 CTACCTCATGGAGCCTTATAT pLKO_005 227 CDS 100% 15.000 10.500 N TADA2A n/a
3 TRCN0000221669 GCTGGTAGAAATGGAACTAAA pLKO.1 1632 3UTR 100% 13.200 9.240 N TADA2A n/a
4 TRCN0000221673 GCAAGAGCACTCATCAAGATA pLKO.1 1245 CDS 100% 5.625 3.938 N TADA2A n/a
5 TRCN0000221670 CGCACTATGCTCTCAGAAGTT pLKO.1 948 CDS 100% 4.950 3.465 N TADA2A n/a
6 TRCN0000274159 TCCAAGAGCTTGGGATCAGAA pLKO_005 1335 3UTR 100% 4.950 3.465 N TADA2A n/a
7 TRCN0000221671 GCTCAAGAAGAAATGGCCCTT pLKO.1 390 CDS 100% 2.160 1.512 N TADA2A n/a
8 TRCN0000221672 GCACTATATGAAGCATTTCAT pLKO.1 497 CDS 100% 0.563 0.394 N TADA2A n/a
9 TRCN0000285153 GCACTATATGAAGCATTTCAT pLKO_005 497 CDS 100% 0.563 0.394 N TADA2A n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2208 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2208 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 2274 3UTR 100% 13.200 6.600 Y IQCC n/a
13 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 1906 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
14 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2370 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024982.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07029 pDONR223 100% 87.7% 87.5% None 7C>T;442_443ins162 n/a
2 ccsbBroad304_07029 pLX_304 0% 87.7% 87.5% V5 7C>T;442_443ins162 n/a
3 TRCN0000474554 CCTCTATGCGGCAGATTTGGTTGA pLX_317 43.5% 87.7% 87.5% V5 7C>T;442_443ins162 n/a
4 ccsbBroadEn_07030 pDONR223 100% 53.9% 48.9% None (many diffs) n/a
5 ccsbBroad304_07030 pLX_304 0% 53.9% 48.9% V5 (many diffs) n/a
6 TRCN0000472083 CTCTTAAAGTCGAATCAAACGTTA pLX_317 45.9% 53.9% 48.9% V5 (many diffs) n/a
Download CSV