Transcript: Human NM_133439.4

Homo sapiens transcriptional adaptor 2A (TADA2A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
TADA2A (6871)
Length:
1307
CDS:
371..1288

Additional Resources:

NCBI RefSeq record:
NM_133439.4
NBCI Gene record:
TADA2A (6871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133439.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274158 TATAAGAGACCATGGATTAAT pLKO_005 1042 CDS 100% 15.000 21.000 N TADA2A n/a
2 TRCN0000274212 TTGAAGATGACTCGGACATTT pLKO_005 948 CDS 100% 13.200 10.560 N TADA2A n/a
3 TRCN0000274211 CTACCTCATGGAGCCTTATAT pLKO_005 436 CDS 100% 15.000 10.500 N TADA2A n/a
4 TRCN0000221671 GCTCAAGAAGAAATGGCCCTT pLKO.1 599 CDS 100% 2.160 1.512 N TADA2A n/a
5 TRCN0000221672 GCACTATATGAAGCATTTCAT pLKO.1 706 CDS 100% 0.563 0.394 N TADA2A n/a
6 TRCN0000285153 GCACTATATGAAGCATTTCAT pLKO_005 706 CDS 100% 0.563 0.394 N TADA2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133439.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07030 pDONR223 100% 99.8% 99.6% None 349C>T n/a
2 ccsbBroad304_07030 pLX_304 0% 99.8% 99.6% V5 349C>T n/a
3 TRCN0000472083 CTCTTAAAGTCGAATCAAACGTTA pLX_317 45.9% 99.8% 99.6% V5 349C>T n/a
4 ccsbBroadEn_07029 pDONR223 100% 66% 60.6% None (many diffs) n/a
5 ccsbBroad304_07029 pLX_304 0% 66% 60.6% V5 (many diffs) n/a
6 TRCN0000474554 CCTCTATGCGGCAGATTTGGTTGA pLX_317 43.5% 66% 60.6% V5 (many diffs) n/a
Download CSV