Construct: ORF TRCN0000472175
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009803.1_s317c1
- Derived from:
- ccsbBroadEn_12851
- DNA Barcode:
- TAAAGTCACCCCCAAATTTCTTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP30 (84749)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472175
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 84749 | USP30 | ubiquitin specific peptidas... | NM_032663.5 | 98.1% | 98.2% | 1_27del;639T>C |
2 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_005253962.3 | 98% | 98% | 1_27del;577_578insAGC;636T>C |
3 | human | 84749 | USP30 | ubiquitin specific peptidas... | NM_001301175.1 | 95.6% | 95.6% | 0_1ins66;546T>C |
4 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_006719653.3 | 95.6% | 95.6% | 0_1ins66;546T>C |
5 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_024449227.1 | 92.3% | 92.3% | 1_27del;639T>C;947_1045del |
6 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020048.1 | 91.6% | 91.6% | 1_27del;639T>C;1168_1278del |
7 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020049.1 | 91.4% | 91.5% | (many diffs) |
8 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020050.1 | 89.1% | 89.1% | 0_1ins66;546T>C;1075_1185del |
9 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020051.2 | 89.1% | 89.1% | 0_1ins66;546T>C;1075_1185del |
10 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020052.2 | 89.1% | 89.1% | 0_1ins66;546T>C;1075_1185del |
11 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_005253965.4 | 86.3% | 86.4% | 1_27del;189_190ins183;456T>C |
12 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_024449228.1 | 83.5% | 83.6% | 0_1ins66;96_97ins183;363T>C |
13 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020053.1 | 80.6% | 80.6% | (many diffs) |
14 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_011538894.2 | 72.3% | 72.4% | 0_1ins417;133_134insAGC;192T>C |
15 | human | 84749 | USP30 | ubiquitin specific peptidas... | XM_017020054.1 | 67.4% | 67.5% | (many diffs) |
16 | mouse | 100756 | Usp30 | ubiquitin specific peptidas... | NM_001033202.3 | 84.2% | 88.2% | (many diffs) |
17 | mouse | 100756 | Usp30 | ubiquitin specific peptidas... | XM_017320581.1 | 84% | 88% | (many diffs) |
18 | mouse | 100756 | Usp30 | ubiquitin specific peptidas... | XM_011248156.2 | 62.4% | 64.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1590
- ORF length:
- 1524
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac cgcggccgac agggccatcc agcgcttcct gcggaccggg gcggccgtca 121 gatataaagt catgaagaac tggggagtta taggtggaat tgctgctgct cttgcagcag 181 gaatatatgt tatttggggt cccattacag aaagaaagaa gcgtagaaaa gggcttgtgc 241 ctggccttgt taatttaggg aacacctgct tcatgaactc cctgctacaa ggcctgtctg 301 cctgtcctgc tttcatcagg tggctggaag agttcacctc ccagtactcc agggatcaga 361 aggagccccc ctcacaccag tatttatcct taacactctt gcaccttctg aaagccttgt 421 cctgccaaga agttactgat gatgaggtct tagatgcaag ctgcttgttg gatgtcttaa 481 gaatgtacag atggcagatc tcatcatttg aagaacagga tgctcacgaa ttattccatg 541 tcattacctc gtcattggaa gatgagcgag accgccagcc tcgggtcaca catttgtttg 601 atgtgcattc cctggagcag cagtcagaaa taactcccaa acaaattacc tgccgcacaa 661 gagggtcacc tcaccccaca tccaatcact ggaagtctca acatcctttt catggaagac 721 tcactagtaa tatggtctgc aaacactgtg aacaccagag tcctgttcga tttgatacct 781 ttgatagcct ttcactaagt attccagccg ccacatgggg tcacccattg accctggacc 841 actgccttca ccacttcatc tcatcagaat cagtgcggga tgttgtgtgt gacaactgta 901 caaagattga agccaaggga acgttgaacg gggaaaaggt ggaacaccag aggaccactt 961 ttgttaaaca gttaaaacta gggaagctcc ctcagtgtct ctgcatccac ctacagcggc 1021 tgagctggtc cagccacggc acgcctctga agcggcatga gcacgtgcag ttcaatgagt 1081 tcctgatgat ggacatttac aagtaccacc tccttggaca taaacctagt caacacaaCC 1141 CTAAACTGAA CAAGAACCCA GGGCCTACAC TGGAGCTGCA GGATGGGCCG GGAGCCCCCA 1201 CACCAGTTCT GAATCAGCCA GGGGCCCCCA AAACACAGAT TTTTATGAAT GGCGCCTGCT 1261 CCCCATCTTT ATTGCCAACG CTGTCAGCGC CGATGCCCTT CCCTCTCCCA GTTGTTCCCG 1321 ACTACAGCTC CTCCACATAC CTCTTCCGGC TGATGGCAGT TGTCGTCCAC CATGGAGACA 1381 TGCACTCTGG ACACTTTGTC ACTTACCGAC GGTCCCCACC TTCTGCCAGG AACCCTCTCT 1441 CAACTAGCAA TCAGTGGCTG TGGGTCTCCG ATGACACTGT CCGCAAGGCC AGCCTGCAGG 1501 AGGTCCTGTC CTCCAGCGCC TACCTGCTGT TCTACGAGCG CGTCCTTTCC AGGATGCAGC 1561 ACCAGAGCCA GGAGTGCAAG TCTGAAGAAT GCCCAACTTT CTTGTACAAA GTGGTTGATA 1621 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1681 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATAAAG 1741 TCACCCCCAA ATTTCTTAAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1801 tgaaagatt