Transcript: Human XM_017020050.1

PREDICTED: Homo sapiens ubiquitin specific peptidase 30 (USP30), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP30 (84749)
Length:
3964
CDS:
298..1869

Additional Resources:

NCBI RefSeq record:
XM_017020050.1
NBCI Gene record:
USP30 (84749)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020050.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368949 TTTAATAAGCAGGCCCATAAA pLKO_005 2247 3UTR 100% 13.200 18.480 N USP30 n/a
2 TRCN0000038820 CCTAGTCAACACAACCCTAAA pLKO.1 1291 CDS 100% 10.800 15.120 N USP30 n/a
3 TRCN0000363662 CCTAGTCAACACAACCCTAAA pLKO_005 1291 CDS 100% 10.800 15.120 N USP30 n/a
4 TRCN0000344593 CTCATCTGATACAGGTAATTA pLKO_005 2121 3UTR 100% 15.000 10.500 N USP30 n/a
5 TRCN0000368950 GCTCTTGCAGCAGGAATATAT pLKO_005 334 CDS 100% 15.000 10.500 N USP30 n/a
6 TRCN0000344595 GAACAGGATGCTCACGAATTA pLKO_005 679 CDS 100% 13.200 9.240 N USP30 n/a
7 TRCN0000344594 GATAGCCTTTCACTAAGTATT pLKO_005 949 CDS 100% 13.200 9.240 N USP30 n/a
8 TRCN0000038823 CACACCAGTATTTATCCTTAA pLKO.1 539 CDS 100% 10.800 7.560 N USP30 n/a
9 TRCN0000038822 CCATGTCATTACCTCGTCATT pLKO.1 702 CDS 100% 4.950 3.465 N USP30 n/a
10 TRCN0000332924 CCATGTCATTACCTCGTCATT pLKO_005 702 CDS 100% 4.950 3.465 N USP30 n/a
11 TRCN0000038821 CCTGTTCGATTTGATACCTTT pLKO.1 928 CDS 100% 4.950 3.465 N USP30 n/a
12 TRCN0000038819 CTGTTGTGTTAAGAAAGCATT pLKO.1 2076 3UTR 100% 4.950 2.970 N USP30 n/a
13 TRCN0000173087 CAGATGAGGAAACTGAGGCTT pLKO.1 212 5UTR 100% 2.640 1.320 Y FLJ45966 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020050.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12851 pDONR223 100% 89.1% 89.1% None 0_1ins66;546T>C;1075_1185del n/a
2 ccsbBroad304_12851 pLX_304 0% 89.1% 89.1% V5 0_1ins66;546T>C;1075_1185del n/a
3 TRCN0000472175 TAAAGTCACCCCCAAATTTCTTAA pLX_317 29.9% 89.1% 89.1% V5 0_1ins66;546T>C;1075_1185del n/a
4 TRCN0000487932 TGGAGCCCGATACTTACTTGACAC pLX_317 16.9% 89.1% 89.1% V5 (not translated due to prior stop codon) 0_1ins66;546T>C;1075_1185del n/a
5 TRCN0000491356 ATCGCTGCCCGGGCTCGGGTGGGT pLX_317 4.3% 89% 89% V5 (many diffs) n/a
Download CSV