Transcript: Mouse NM_001033202.3

Mus musculus ubiquitin specific peptidase 30 (Usp30), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Usp30 (100756)
Length:
2790
CDS:
101..1654

Additional Resources:

NCBI RefSeq record:
NM_001033202.3
NBCI Gene record:
Usp30 (100756)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033202.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030885 CCTGTTCGGTTTGACACCTTT pLKO.1 824 CDS 100% 4.950 3.960 N Usp30 n/a
2 TRCN0000030884 GCACCTTTGTTAAACAGTTAA pLKO.1 1017 CDS 100% 13.200 9.240 N Usp30 n/a
3 TRCN0000030887 GCAACCAATGGCTGTGGATTT pLKO.1 1509 CDS 100% 10.800 7.560 N Usp30 n/a
4 TRCN0000030886 CCTGATGATGGACTTCTACAA pLKO.1 1144 CDS 100% 4.950 3.465 N Usp30 n/a
5 TRCN0000030888 CACCAGTAACATGGTGTGCAA pLKO.1 784 CDS 100% 0.264 0.185 N Usp30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033202.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12851 pDONR223 100% 84.2% 88.2% None (many diffs) n/a
2 ccsbBroad304_12851 pLX_304 0% 84.2% 88.2% V5 (many diffs) n/a
3 TRCN0000472175 TAAAGTCACCCCCAAATTTCTTAA pLX_317 29.9% 84.2% 88.2% V5 (many diffs) n/a
4 TRCN0000487932 TGGAGCCCGATACTTACTTGACAC pLX_317 16.9% 84.2% 88.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491356 ATCGCTGCCCGGGCTCGGGTGGGT pLX_317 4.3% 84.1% 88% V5 (many diffs) n/a
Download CSV