Construct: ORF TRCN0000472281
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016193.1_s317c1
- Derived from:
- ccsbBroadEn_12667
- DNA Barcode:
- GACTAAAAACAGGACTTTACAAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LRRTM4 (80059)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472281
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 80059 | LRRTM4 | leucine rich repeat transme... | NM_024993.6 | 39.9% | 39.9% | 1_933del |
| 2 | human | 80059 | LRRTM4 | leucine rich repeat transme... | NM_001282928.3 | 39.8% | 39.8% | 1_936del |
| 3 | human | 80059 | LRRTM4 | leucine rich repeat transme... | NM_001134745.2 | 34.9% | 34.9% | 1_933del;1552A>G;1554_1770delinsA |
| 4 | human | 80059 | LRRTM4 | leucine rich repeat transme... | NM_001282924.2 | 34.9% | 34.9% | 1_933del;1552A>G;1554_1770delinsA |
| 5 | human | 80059 | LRRTM4 | leucine rich repeat transme... | NM_001330370.1 | 34.9% | 34.8% | 1_936del;1555A>G;1557_1773delinsA |
| 6 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | NM_178731.5 | 34.3% | 37% | (many diffs) |
| 7 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | NM_001282102.1 | 34.3% | 36.9% | (many diffs) |
| 8 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | XM_006506089.3 | 34.3% | 36.9% | (many diffs) |
| 9 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | XM_011241336.2 | 34.1% | 36.8% | (many diffs) |
| 10 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | XM_006506088.2 | 32.8% | 35.3% | (many diffs) |
| 11 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | NM_001347261.1 | 30.1% | 32.3% | (many diffs) |
| 12 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | XM_006506085.1 | 30.1% | 32.3% | (many diffs) |
| 13 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | XM_006506086.2 | 30.1% | 32.3% | (many diffs) |
| 14 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | XM_006506087.2 | 30.1% | 32.3% | (many diffs) |
| 15 | mouse | 243499 | Lrrtm4 | leucine rich repeat transme... | NM_001134743.1 | 30% | 32.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 687
- ORF length:
- 621
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg ggaatgcagt cggagcattt gtcctttatt ttattggctt aagaatttca 121 aaggaaataa ggaaagcacc atgatatgtg cgggacctaa gcacatccag ggtgaaaagg 181 ttagtgatgc agtggaaaca tataatatct gttctgaagt ccaggtggtc aacacagaaa 241 gatcacacct ggtgccccaa actccccaga aacctctgat tatccctaga cctaccatct 301 tcaaacctga cgtcacccaa tccacctttg aaacaccaag cccTTCCCCA GGGTTTCAGA 361 TTCCTGGCGC AGAGCAAGAG TATGAGCATG TTTCATTTCA CAAAATTATT GCCGGGAGTG 421 TGGCTCTCTT TCTCTCAGTG GCCATGATCC TCTTGGTGAT CTATGTGTCT TGGAAACGCT 481 ACCCAGCCAG CATGAAACAA CTCCAGCAAC ACTCTCTTAT GAAGAGGCGG CGGAAAAAGG 541 CCAGAGAGTC TGAAAGACAA ATGAATTCCC CTTTACAGGA GTATTATGTG GACTACAAGC 601 CTACAAACTC TGAGACCATG GATATATCGG TTAATGGATC TGGGCCCTGC ACATATACCA 661 TCTCTGGCTC CAGGGAATGT GAGGTATGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 721 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 781 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAGACTAAAA 841 ACAGGACTTT ACAAGAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 901 aagatt