Construct: ORF TRCN0000472418
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011805.1_s317c1
- Derived from:
- ccsbBroadEn_15923
- DNA Barcode:
- TCGGATGACCATATTTACAGCTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMPRSS4 (56649)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472418
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56649 | TMPRSS4 | transmembrane serine protea... | XM_011542903.3 | 90.2% | 83.3% | (many diffs) |
| 2 | human | 56649 | TMPRSS4 | transmembrane serine protea... | NM_001173551.1 | 77% | 77% | 1006_1305del |
| 3 | human | 56649 | TMPRSS4 | transmembrane serine protea... | NM_019894.4 | 76.5% | 76.2% | 3_8delGTTACA;623T>G;1012_1311del |
| 4 | human | 56649 | TMPRSS4 | transmembrane serine protea... | NM_001083947.1 | 75.5% | 75.2% | 3_8delGTTACA;437_438insCAGCAAACCCACTTT;997_1296del |
| 5 | human | 56649 | TMPRSS4 | transmembrane serine protea... | NM_001290094.1 | 71.7% | 71.7% | 0_1ins69;937_1236del |
| 6 | human | 56649 | TMPRSS4 | transmembrane serine protea... | NM_001173552.1 | 68.2% | 68% | 37_38ins114;892_1191del |
| 7 | human | 56649 | TMPRSS4 | transmembrane serine protea... | XM_005271614.3 | 68% | 67.8% | 617T>G;1006_1476del |
| 8 | human | 56649 | TMPRSS4 | transmembrane serine protea... | XM_005271613.4 | 67.7% | 67.4% | 3_8delGTTACA;623T>G;1012_1482del |
| 9 | human | 56649 | TMPRSS4 | transmembrane serine protea... | XM_011542901.2 | 66.7% | 66.3% | (many diffs) |
| 10 | human | 56649 | TMPRSS4 | transmembrane serine protea... | XM_011542904.2 | 66.6% | 56.6% | (many diffs) |
| 11 | human | 56649 | TMPRSS4 | transmembrane serine protea... | XM_005271615.3 | 60.2% | 59.9% | 37_38ins114;503T>G;892_1362del |
| 12 | human | 56649 | TMPRSS4 | transmembrane serine protea... | XM_011542902.2 | 60% | 59.5% | (many diffs) |
| 13 | human | 56649 | TMPRSS4 | transmembrane serine protea... | NM_001290096.1 | 43.6% | 43.6% | 0_1ins420;11_12insCAGCAAACCCACTTT;571_870del |
| 14 | human | 56649 | TMPRSS4 | transmembrane serine protea... | NR_110734.1 | 29.5% | 1_291del;1297_3400del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1071
- ORF length:
- 1005
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tcctgacagt gatcaacctc tgaacagcct cgatgtcaaa cccctgcgca 121 aaccccgtat ccccatggag accttcagaa aggtggggat ccccatcatc atagcactac 181 tgagcctggc gagtatcatc attgtggttg tcctcatcaa ggtgattctg gataaatact 241 acttcctctg cgggcagcct ctccacttca tcccgaggaa gcagctgtgt gacggagagc 301 tggactgtcc cttgggggag gacgaggagc actgtgtcaa gagcttcccc gaagggcctg 361 cagtggcagt ccgcctctcc aaggaccgat ccacactgca ggtgctggac tcggccacag 421 ggaactggtt ctctgcctgt ttcgacaact tcacagaagc tctcgctgag acagcctgta 481 ggcagatggg ctacagcagc aaacccactt tcagagctgt ggagattggc ccagaccagg 541 atctggatgt tgttgaaatc acagaaaaca gccaggagct tcgcatgcgg aactcaagtg 601 ggccctgtct ctcaggctcc ctggtctccc tgcactgtct tgcctgtggg aagagccTGA 661 AGACCCCCCG TGTGGTGGGT GGGGAGGAGG CCTCTGTGGA TTCTTGGCCT TGGCAGGTCA 721 GCATCCAGTA CGACAAACAG CACGTCTGTG GAGGGAGCAT CCTGGACCCC CACTGGGTCC 781 TCACGGCAGC CCACTGCTTC AGGAAACATA CCGATGTGTT CAACTGGAAG GTGCGGGCAG 841 GCTCAGACAA ACTGGGCAGC TTCCCATCCC TGGCTGTGGC CAAGATCATC ATCATTGAAT 901 TCAACCCCAT GTACCCCAAA GACAATGACA TCGCCCTCAT GAAGCTGCAG TTCCCACTCA 961 CTTTCTCAGG CACAGTCAGG CCCATCTGTC TGCCCTTCTT TGATGAGGAG CTCACTCCAG 1021 CCACCCCACT CTGGATCATT GGATGGGGCT TTACGAAGCA GAATGGAGGG TGCCCAACTT 1081 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1141 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1201 CTTGTGGAAA GGACGATCGG ATGACCATAT TTACAGCTTA ACGCGTTAAG TCgacaatca 1261 acctctggat tacaaaattt gtgaaagatt