Transcript: Human NM_019894.4

Homo sapiens transmembrane serine protease 4 (TMPRSS4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
TMPRSS4 (56649)
Length:
5516
CDS:
226..1539

Additional Resources:

NCBI RefSeq record:
NM_019894.4
NBCI Gene record:
TMPRSS4 (56649)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019894.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445182 TGTTGGTATGACTACCGTTAC pLKO_005 1997 3UTR 100% 6.000 8.400 N TMPRSS4 n/a
2 TRCN0000051584 GCGAGTATCATCATTGTGGTT pLKO.1 355 CDS 100% 2.640 3.696 N TMPRSS4 n/a
3 TRCN0000454412 GGATCTGGATGTTGTTGAAAT pLKO_005 705 CDS 100% 13.200 9.240 N TMPRSS4 n/a
4 TRCN0000051587 CCCACTGCTTCAGGAAACATA pLKO.1 956 CDS 100% 5.625 3.938 N TMPRSS4 n/a
5 TRCN0000051583 CCAAGCCTACTAGAGCAAGAA pLKO.1 1945 3UTR 100% 4.950 3.465 N TMPRSS4 n/a
6 TRCN0000051585 GTCAGCATCCAGTACGACAAA pLKO.1 883 CDS 100% 4.950 3.465 N TMPRSS4 n/a
7 TRCN0000051586 GAAGATGATGTGTGCAGGCAT pLKO.1 1329 CDS 100% 2.640 1.584 N TMPRSS4 n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5242 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5242 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019894.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08646 pDONR223 100% 99.7% 99.5% None 18C>G;623T>G;1215T>C n/a
2 ccsbBroad304_08646 pLX_304 0% 99.7% 99.5% V5 18C>G;623T>G;1215T>C n/a
3 TRCN0000471065 TGGCACCATTAGATCTGCTGCTTT pLX_317 39.4% 99.7% 99.5% V5 18C>G;623T>G;1215T>C n/a
4 ccsbBroadEn_15923 pDONR223 0% 76.5% 76.2% None 3_8delGTTACA;623T>G;1012_1311del n/a
5 ccsbBroad304_15923 pLX_304 0% 76.5% 76.2% V5 3_8delGTTACA;623T>G;1012_1311del n/a
6 TRCN0000472418 TCGGATGACCATATTTACAGCTTA pLX_317 41.3% 76.5% 76.2% V5 3_8delGTTACA;623T>G;1012_1311del n/a
Download CSV