Transcript: Human XM_005271614.3

PREDICTED: Homo sapiens transmembrane serine protease 4 (TMPRSS4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMPRSS4 (56649)
Length:
1737
CDS:
231..1709

Additional Resources:

NCBI RefSeq record:
XM_005271614.3
NBCI Gene record:
TMPRSS4 (56649)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271614.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051584 GCGAGTATCATCATTGTGGTT pLKO.1 354 CDS 100% 2.640 3.696 N TMPRSS4 n/a
2 TRCN0000454412 GGATCTGGATGTTGTTGAAAT pLKO_005 704 CDS 100% 13.200 9.240 N TMPRSS4 n/a
3 TRCN0000051587 CCCACTGCTTCAGGAAACATA pLKO.1 955 CDS 100% 5.625 3.938 N TMPRSS4 n/a
4 TRCN0000051585 GTCAGCATCCAGTACGACAAA pLKO.1 882 CDS 100% 4.950 3.465 N TMPRSS4 n/a
5 TRCN0000051586 GAAGATGATGTGTGCAGGCAT pLKO.1 1328 CDS 100% 2.640 1.584 N TMPRSS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271614.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08646 pDONR223 100% 87.7% 86.8% None (many diffs) n/a
2 ccsbBroad304_08646 pLX_304 0% 87.7% 86.8% V5 (many diffs) n/a
3 TRCN0000471065 TGGCACCATTAGATCTGCTGCTTT pLX_317 39.4% 87.7% 86.8% V5 (many diffs) n/a
4 ccsbBroadEn_15923 pDONR223 0% 68% 67.8% None 617T>G;1006_1476del n/a
5 ccsbBroad304_15923 pLX_304 0% 68% 67.8% V5 617T>G;1006_1476del n/a
6 TRCN0000472418 TCGGATGACCATATTTACAGCTTA pLX_317 41.3% 68% 67.8% V5 617T>G;1006_1476del n/a
Download CSV