Transcript: Human NM_001173551.1

Homo sapiens transmembrane serine protease 4 (TMPRSS4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
TMPRSS4 (56649)
Length:
3543
CDS:
292..1599

Additional Resources:

NCBI RefSeq record:
NM_001173551.1
NBCI Gene record:
TMPRSS4 (56649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001173551.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445182 TGTTGGTATGACTACCGTTAC pLKO_005 2057 3UTR 100% 6.000 8.400 N TMPRSS4 n/a
2 TRCN0000051584 GCGAGTATCATCATTGTGGTT pLKO.1 415 CDS 100% 2.640 3.696 N TMPRSS4 n/a
3 TRCN0000454412 GGATCTGGATGTTGTTGAAAT pLKO_005 765 CDS 100% 13.200 9.240 N TMPRSS4 n/a
4 TRCN0000051587 CCCACTGCTTCAGGAAACATA pLKO.1 1016 CDS 100% 5.625 3.938 N TMPRSS4 n/a
5 TRCN0000051583 CCAAGCCTACTAGAGCAAGAA pLKO.1 2005 3UTR 100% 4.950 3.465 N TMPRSS4 n/a
6 TRCN0000051585 GTCAGCATCCAGTACGACAAA pLKO.1 943 CDS 100% 4.950 3.465 N TMPRSS4 n/a
7 TRCN0000051586 GAAGATGATGTGTGCAGGCAT pLKO.1 1389 CDS 100% 2.640 1.584 N TMPRSS4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001173551.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08646 pDONR223 100% 99.3% 99% None 2_3insGTTACA;12C>G;1209T>C n/a
2 ccsbBroad304_08646 pLX_304 0% 99.3% 99% V5 2_3insGTTACA;12C>G;1209T>C n/a
3 TRCN0000471065 TGGCACCATTAGATCTGCTGCTTT pLX_317 39.4% 99.3% 99% V5 2_3insGTTACA;12C>G;1209T>C n/a
4 ccsbBroadEn_15923 pDONR223 0% 77% 77% None 1006_1305del n/a
5 ccsbBroad304_15923 pLX_304 0% 77% 77% V5 1006_1305del n/a
6 TRCN0000472418 TCGGATGACCATATTTACAGCTTA pLX_317 41.3% 77% 77% V5 1006_1305del n/a
Download CSV