Transcript: Human XM_011539501.2

PREDICTED: Homo sapiens receptor accessory protein 3 (REEP3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
REEP3 (221035)
Length:
9818
CDS:
194..652

Additional Resources:

NCBI RefSeq record:
XM_011539501.2
NBCI Gene record:
REEP3 (221035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134552 GAAGGAATATGTTCGATGGAT pLKO.1 289 CDS 100% 3.000 4.200 N REEP3 n/a
2 TRCN0000137535 CGGCAAGGTTTAAACCTTGCA pLKO.1 560 CDS 100% 0.264 0.370 N REEP3 n/a
3 TRCN0000137150 GTGATTGAAACAGTAGCCGAT pLKO.1 341 CDS 100% 2.160 1.728 N REEP3 n/a
4 TRCN0000190885 CCTGTACTATGAGCTGAAGAT pLKO.1 382 CDS 100% 4.950 3.465 N Reep3 n/a
5 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2597 3UTR 100% 4.950 2.475 Y CFLAR n/a
6 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2597 3UTR 100% 4.950 2.475 Y C19orf31 n/a
7 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 4047 3UTR 100% 4.050 2.025 Y LOC441087 n/a
8 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1998 3UTR 100% 10.800 5.400 Y SMIM11A n/a
9 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2595 3UTR 100% 4.950 2.475 Y ERN2 n/a
10 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2595 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2595 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05248 pDONR223 100% 57.5% 53.6% None (many diffs) n/a
2 ccsbBroad304_05248 pLX_304 0% 57.5% 53.6% V5 (many diffs) n/a
3 TRCN0000472512 GATCCGGGCCGTATGCATCGACCG pLX_317 52.6% 57.5% 53.6% V5 (many diffs) n/a
Download CSV