Construct: ORF TRCN0000472576
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008236.1_s317c1
- Derived from:
- ccsbBroadEn_13825
- DNA Barcode:
- CTGATAGGACTATTAAGCTCCGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ENTPD5 (957)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472576
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | NM_001330189.2 | 99.8% | 99.5% | 8C>G;10T>G |
| 2 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | XM_006720325.3 | 99.8% | 99.5% | 8C>G;10T>G |
| 3 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | XM_017021814.1 | 99.8% | 99.5% | 8C>G;10T>G |
| 4 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | NM_001321984.2 | 97.8% | 97.7% | (many diffs) |
| 5 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | NM_001249.4 | 94.2% | 93.2% | (many diffs) |
| 6 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | NM_001321985.2 | 94.2% | 93.2% | (many diffs) |
| 7 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | NM_001321986.2 | 94.2% | 93.2% | (many diffs) |
| 8 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | NM_001321987.2 | 94.2% | 93.2% | (many diffs) |
| 9 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | NM_001321988.2 | 94.2% | 93.2% | (many diffs) |
| 10 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | XM_005268224.3 | 94.2% | 93.2% | (many diffs) |
| 11 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | XM_017021813.1 | 94.2% | 93.2% | (many diffs) |
| 12 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | XM_024449758.1 | 94.2% | 93.2% | (many diffs) |
| 13 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | XM_017021817.1 | 88.2% | 87.9% | 8C>G;10T>G;885_886ins141 |
| 14 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | XM_006720326.2 | 83.3% | 82.2% | (many diffs) |
| 15 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | XM_017021816.1 | 83.3% | 82.2% | (many diffs) |
| 16 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | XR_001750611.2 | 69% | (many diffs) | |
| 17 | human | 957 | ENTPD5 | ectonucleoside triphosphate... | XR_001750612.1 | 68.3% | (many diffs) | |
| 18 | mouse | 12499 | Entpd5 | ectonucleoside triphosphate... | NM_001026214.2 | 81.9% | 81.8% | (many diffs) |
| 19 | mouse | 12499 | Entpd5 | ectonucleoside triphosphate... | NM_001286049.1 | 81.9% | 81.8% | (many diffs) |
| 20 | mouse | 12499 | Entpd5 | ectonucleoside triphosphate... | NM_001286058.1 | 81.9% | 81.8% | (many diffs) |
| 21 | mouse | 12499 | Entpd5 | ectonucleoside triphosphate... | NM_007647.3 | 77.4% | 77.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1287
- ORF length:
- 1221
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cagtgcttgg ggcacagtct ttttcatgct ggtggtatcc tgtgtttgca 121 gcgctgtctc ccacaggaac cagcagactt ggtttgaggg tatcttcctg tcttccatgt 181 gccccatcaa tgtcagcgcc agcaccttgt atggaattat gtttgatgca gggagcactg 241 gaactcgaat tcatgtttac acctttgtgc agaaaatgcc aggacagctt ccaattctag 301 aaggggaagt ttttgattct gtgaagccag gactttctgc ttttgtagat caacctaagc 361 agggtgctga gaccgttcaa gggctcttag aggtggccaa agactcaatc ccccgaagtc 421 actggaaaaa gaccccagtg gtcctaaagg caacagcagg actacgctta ctgccagaac 481 acaaagccaa ggctctgctc tttgaggtaa aggagatctt caggaagtca cctttcctgg 541 taccaaaggg cagtgttagc atcatggatg gatccgacga aggcatatta gcttgggtta 601 ctgtgaattt tctgacaggt cagctgcatg gccacagaca ggagactgtg gggaccttgg 661 acctaggggg agcctccacc caaatcacgt tcctgcccca gtttgagaaa actctggaac 721 aaactcctag gggctacctc acttcctttg agatgtttaa cagcacttat aagctctata 781 cacatagtta cctgggattt ggattgaaag ctgcaagact agcaaccctg ggagccctgg 841 agacagaagg gactgatggg cacactttcc ggagtgcctg tttaccgaga tggttggaag 901 cagagtggaT CTTTGGGGGT GTGAAATACC AGTATGGTGG CAACCAAGAA GGGGAGGTGG 961 GCTTTGAGCC CTGCTATGCC GAAGTGCTGA GGGTGGTACG AGGAAAACTT CACCAGCCAG 1021 AGGAGGTCCA GAGAGGTTCC TTCTATGCTT TCTCTTACTA TTATGACCGA GCTGTTGACA 1081 CAGACATGAT TGATTATGAA AAGGGGGGTA TTTTAAAAGT TGAAGATTTT GAAAGAAAAG 1141 CCAGGGAAGT GTGTGATAAC TTGGAAAACT TCACCTCAGG CAGTCCTTTC CTGTGCATGG 1201 ATCTCAGCTA CATCACAGCC CTGTTAAAGG ATGGCTTTGG CTTTGCAGAC AGCACAGTCT 1261 TACAGCACAT CATCAGCTGG GTAAATTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1321 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1381 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACTGATAGG 1441 ACTATTAAGC TCCGCAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1501 aagatt